candidate fusion list

The following tables show fusion candidates where fusions are grouped based on their genomic locations (table description)
sample information
Known fusions are found at Mitelman Database as of Feb 11, 2011

1. chr20-chr17 ff (confirmed)
MCF7 BCAS4 chr20 49411707 BCAS3 chr17 59430946 9 3 9
MCF7 BCAS4 chr20 49411707 BCAS3 chr17 59445685 106 116 167

2. chr20-chr20 fr (confirmed)
MCF7 ARFGEF2 chr20 47538545 SULF2 chr20 46365686 17 11 9

3. chr17-chr17 ff (confirmed)
MCF7 RPS6KB1 chr17 57992061 TMEM49 chr17 57917126 4 2 1

4. chr20-chr20 rf
MCF7 SULF2 chr20 46415145 ENSG00000171940 chr20 52210297 22 18 27
MCF7 SULF2 chr20 46415146 ENSG00000171940 chr20 52210647 11 18 14

5. chr17-chr17 ff
MCF7 ENSG00000224738 chr17 57184949 TMEM49 chr17 57915653 5 3 3

6. chr2-chr17 rr
MCF7 LRP1B chr2 142237963 PLXDC1 chr17 37265642 2 3 2

7. chr2-chr5 rf
MCF7 ENSG00000226505 chr2 70329650 MRPL36 chr5 1799907 5 14 1

sample list

sample name fragment length read length # of fragments
BT474 150 50 21423697
KPL4 100 50 6796443
MCF7 100 50 8409785
SKBR3 150 50 18140246

table description

1. Sample name in which a fusion is identified
2. Gene on the "left" side of the fusion
3. Chromosome ID on the left
4. Coordinates on the left
5. Gene on the "right" side
6. Chromosome ID on the right
7. Coordinates on the right
8. Number of spanning reads
9. Number of spanning mate pairs
10. Number of spanning mate pairs where one end spans a fusion
If you follow the the 9th column, it shows coordinates "number1:number2" where one end is located at a distance of "number1" bases from the left genomic coordinate of a fusion and "number2" is similarly defined

MCF7 chr2-chr17 142237963 37265642 rr

2 3 2 0 24 26
00000000000000000000000000222222222222222222222222 22222222222222222222222222000000000000000000000000
LRP1B exon89(142237963-142238101) PLXDC1 exon12(37265499-37265643)

blast search - human genome


>ref|NC_000002.11| Homo sapiens chromosome 2, GRCh37.p2 primary reference assembly
          Length = 243199373

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1         ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 50
Sbjct: 142238013 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 142237964

>ref|AC_000134.1| Homo sapiens chromosome 2, alternate assembly HuRef, whole genome shotgun
          Length = 234808360

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1         ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 50
Sbjct: 134228846 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 134228797

>ref|AC_000045.1| Homo sapiens chromosome 2, alternate assembly Hs_Celera, whole genome shotgun
          Length = 236827137

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1         ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 50
Sbjct: 135950439 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcaggg 135950390


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 37265643 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 37265594

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 33061168 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 33061119

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 33926460 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 33926411

blast search - nt


>ref|XM_001156822.1| PREDICTED: Pan troglodytes low density lipoprotein-related protein
            1B, transcript variant 1 (LRP1B), mRNA
          Length = 16532

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 1    ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 49
Sbjct: 1266 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 1314

>ref|XM_515817.2| PREDICTED: Pan troglodytes low density lipoprotein-related protein
           1B, transcript variant 2 (LRP1B), mRNA
          Length = 15796

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 1   ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 49
Sbjct: 530 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 578

>ref|NM_018557.2| Homo sapiens low density lipoprotein receptor-related protein 1B
            (LRP1B), mRNA
          Length = 16557

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 1    ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 49
Sbjct: 1267 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 1315

>gb|AF176832.1|AF176832 Homo sapiens low density lipoprotein receptor related protein-deleted
            in tumor (LRPDIT) mRNA, complete cds
          Length = 16556

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 1    ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 49
Sbjct: 1267 ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 1315

>ref|XM_001117994.2| PREDICTED: Macaca mulatta low density lipoprotein receptor-related
            protein 1B (LRP1B), mRNA
          Length = 16519

 Score = 89.7 bits (45), Expect = 1e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

Query: 1    ggtgtcttggactgcccagatgggtatgacgaaggagtacattgtcagg 49
            |||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1258 ggtgtcttggactgcccagacgggtatgacgaaggagtacattgtcagg 1306


>ref|XM_002827668.1| PREDICTED: Pongo abelii plexin domain-containing protein 1-like
           (LOC100461206), mRNA
          Length = 3033

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 560 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 609

>ref|NM_020405.4| Homo sapiens plexin domain containing 1 (PLXDC1), mRNA
          Length = 6271

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 469 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 518

>dbj|AK303699.1| Homo sapiens cDNA FLJ58221 complete cds, highly similar to Plexin
           domain-containing protein 1 precursor
          Length = 2082

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 156 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 205

>gb|EU832116.1| Synthetic construct Homo sapiens clone HAIB:100067145;
           DKFZo008C0625 plexin domain containing 1 protein
           (PLXDC1) gene, encodes complete protein
          Length = 1546

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 279 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 328

>gb|EU832210.1| Synthetic construct Homo sapiens clone HAIB:100067239;
           DKFZo004C0626 plexin domain containing 1 protein
           (PLXDC1) gene, encodes complete protein
          Length = 1546

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 279 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 328

>dbj|AK312999.1| Homo sapiens cDNA, FLJ93462, highly similar to Homo sapiens plexin
           domain containing 1 (PLXDC1), mRNA
          Length = 1537

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 291 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 340

>gb|AC004408.2| Homo sapiens chromosome 17, clone RP5-906A24, complete sequence
          Length = 113250

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1    aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 8392 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 8343

>ref|XM_001172534.1| PREDICTED: Pan troglodytes similar to tumor endothelial marker
           7-secreted 1 precursor, transcript variant 1
           (LOC454623), mRNA
          Length = 1126

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 284 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 333

>ref|XM_001172579.1| PREDICTED: Pan troglodytes similar to tumor endothelial marker
           7-secreted 1 precursor, transcript variant 3
           (LOC454623), mRNA
          Length = 1386

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 544 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 593

>ref|XM_511448.2| PREDICTED: Pan troglodytes similar to tumor endothelial marker
           7-secreted 1 precursor, transcript variant 5
           (LOC454623), mRNA
          Length = 3003

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 544 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 593

>ref|XM_001172555.1| PREDICTED: Pan troglodytes similar to tumor endothelial marker
           7-secreted 1 precursor, transcript variant 2
           (LOC454623), mRNA
          Length = 1311

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 469 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 518

>ref|XM_001172591.1| PREDICTED: Pan troglodytes similar to tumor endothelial marker
           7-secreted 1 precursor, transcript variant 4
           (LOC454623), mRNA
          Length = 2964

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 469 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 518

>gb|AY704672.1| Homo sapiens tumor endothelial marker 7-intracellular precursor
           (TEM7) mRNA, complete cds; alternatively spliced
          Length = 2630

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 285 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 334

>gb|AY704671.1| Homo sapiens tumor endothelial marker 7-secreted 2 precursor (TEM7)
           mRNA, complete cds; alternatively spliced
          Length = 2884

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 339 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 388

>gb|AY704670.1| Homo sapiens tumor endothelial marker 7-secreted 1 precursor (TEM7)
           mRNA, complete cds; alternatively spliced
          Length = 2684

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 339 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 388

>dbj|AK127539.1| Homo sapiens cDNA FLJ45632 fis, clone CHONS2001834, highly  similar
           to Homo sapiens tumor endothelial marker 7 precursor
          Length = 2604

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 286 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 335

>dbj|AK093589.1| Homo sapiens cDNA FLJ36270 fis, clone THYMU2003046, highly similar
           to Plexin domain-containing protein 1 precursor
          Length = 2722

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 490 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 539

>gb|BC036059.1| Homo sapiens plexin domain containing 1, mRNA (cDNA clone MGC:33667
           IMAGE:5298499), complete cds
          Length = 2405

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 435 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 484

>gb|AC091178.7| Homo sapiens chromosome 17, clone CTD-2206N4, complete sequence
          Length = 99268

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 90598 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 90549

>gb|AF378753.1|AF378753 Homo sapiens tumor endothelial marker 3 precursor (TEM7) mRNA,
           complete cds
          Length = 6140

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 339 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 388

>gb|AF279144.2|AF279144 Homo sapiens tumor endothelial marker 7 precursor (TEM7) mRNA,
           complete cds
          Length = 2320

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
Sbjct: 339 aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 388

>ref|XM_002800444.1| PREDICTED: Macaca mulatta plexin domain containing 1 (PLXDC1), mRNA
          Length = 2196

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   aggacaaccacagctattatgtgtcccgtctctatggccccagcgagccc 50
           ||||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 150 aggacaaccacagttattatgtgtcccgtctctatggccccagtgagccc 199


chr2 chr2 142567887 142238092 41m329745n9m                   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTCCCGAGG
chr2 chr2 142567870 142238075 24m329745n26m                  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTCCCGAGGAGGTAGAAATCAAGTGC
chr2 chr2 142567867 142238072 21m329745n29m                  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTCCCGAGGAGGTAGAAATCAAGTGCCCC
chr2 chr2 142567851 142238056 5m329745n45m                   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTCCCGAGGAGGTAGAAATCAAGTGCCCCTTGAATCACATTGCTT
chr2 chr2 142238101 142238051 50m                                                                                                                                                                                              GTCCCGAGGAGGTAGAAATCAAGTGCCCCTTGAATCACATTGCTTGCCTT
chr2 chr2 142238097 142238047 50m                                                                                                                                                                                                  CGAGGAGGTAGAAATCAAGTGCCCCTTGAATCACATTGCTTGCCTTGGTA
chr2 chr2 142238094 142238044 50m                                                                                                                                                                                                     GGAGGTAGAAATCAAGTGCCCCTTGAATCACATTGCTCGCCTTGGTACCA
chr2 chr2 142238090 142238040 50m                                                                                                                                                                                                         GTAGAAATCAAGTGCCCCTTGAATCACATTGCTTGCCTTGGTACCAACAA
chr2 chr2 142238086 142238036 50m                                                                                                                                                                                                             AAATCAAGTGCCCCTTGAATCACATTGCTTGCCTTGGTACCAACAAATGT
chr2 chr2 142238071 142238021 50m                                                                                                                                                                                                                            TGAATCACATTGCTTGCCTTGGTACCAACAAATGTGTTCATTTATCCCAG
chr2 chr2 142238066 142238016 50m                                                                                                                                                                                                                                 CACATTGCTTGCCTTGGTACCAACAAATGTGTTCATTTATCCCAGCTGTG
chr2 chr2 142238062 142238012 50m                                                                                                                                                                                                                                     TTGCTTGCCTTGGTACCAACAAATGTGTTCATTTATCCCAGCTGTGCAAT
chr2 chr2 142238058 142238008 50m                                                                                                                                                                                                                                         TTGCCTTGGTACCAACAAATGTGTTCATTTATCCCAGCTGTGCAATGGCG
chr2 chr2 142238046 142237996 50m                                                                                                                                                                                                                                                     CAACAAATGTGTTCATTTATCCCAGCTGTGCAATGGTGTCTTGGACTGCC
chr2 chr2 142238043 142237993 50m                                                                                                                                                                                                                                                        CAAATGTGTTCATTTATCCCAGCTGTGCAATGGTGTCTTGGACTGCCCAG
chr2 chr2 142238028 142237978 50m                                                                                                                                                                                                                                                                       ATCCCAGCTGTGCAATGGTGTCTTGGACTGCCCAGATGGGTATGACGAAG
chr2 chr2 142238025 142237975 50m                                                                                                                                                                                                                                                                          CCAGCTGTGCAATGGTGTCTTGGACTGCCCAGATGGGTATGACGAAGGAG
chr2 chr2 142238019 142237969 50m                                                                                                                                                                                                                                                                                GTGCAATGGTGTCTTGGACTGCCCAGATGGGTATGACGAAGGAGTACATT
chr2 chr2 142238014 142237964 50m                                                                                                                                                                                                                                                                                     ATGGTGTCTTGGACTGCCCAGATGGGTATGACGAAGGAGTACATTGTCAG
chr2 chr17 142237986 37265616 24m37265642F26m                                                                                                                                                                                                                                                                                                     TGACGAAGGAGTACATTGTCAGGG AGGACAACCACAGCTATTATGTGTCC
chr2 chr17 142237986 37265616 24m37265642F26m                                                                                                                                                                                                                                                                                                     TGACGAAGGAGTACATTGTCAGGG AGGACAACCACAGCTATTATGTGTCC
chr17 chr17 37265645 37265595 50m                                                                                                                                                                                                                                                                                                                                       GGGAGGACAACCACAGCTATTATGTGTCCCGTCTCTATGGCCCCAGCGAG
chr17 chr17 37265629 37265579 50m                                                                                                                                                                                                                                                                                                                                                       CTATTATGTGTCCCGTCTCTATGGTCCCAGCGAGCCCCACAGCCGGGAAC
chr17 chr17 37265609 37265559 50m                                                                                                                                                                                                                                                                                                                                                                           ATGGCCCCAGCGAGCCCCACAGCCGGGAACTGTGGGTAGATGTGGCCGAG
chr17 chr17 37265606 37265556 50m                                                                                                                                                                                                                                                                                                                                                                              GCCCCAGCGAGCCCCACAGCCGGGAACTGTGGGTAGATGTGGCCGAGGCC
chr17 chr17 37265582 37265532 50m                                                                                                                                                                                                                                                                                                                                                                                                      AACTGTGGGTAGATGTGGCCGAGGCCAACCGGAGCCAAGTGAAGATCCAC
chr17 chr17 37265570 37265520 50m                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGGCCGAGGCCAACCGGAGCCAAGTGAAGATCCACACAATACTCTCC
chr17 chr17 37265563 37265513 50m                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGGCCAACCGGAGCCAAGTGAAGATCCACACAATACTCTCCAACACCC
chr17 chr17 37265556 37265506 50m                                                                                                                                                                                                                                                                                                                                                                                                                                AACCGGAGCCAAGTGAAGATCCACACAATACTCTCCAACACCCACCGGCA

3 pairs


MCF7 chr20-chr20 47538545 46365686 fr

17 11 9 0 37 37
00000000000001123335666666778889999999999999999999 99999999999999999999999999999996533110000000000000
ARFGEF2 exon1(47538273-47538546) SULF2 exon19(46365445-46365685)

blast search - human genome


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 47538497 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 47538546

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 44290015 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 44290064

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 44243113 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 44243162


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 46365687 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 46365638

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 43107380 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 43107331

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 43079378 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 43079329

blast search - nt


>ref|XM_003134493.1| PREDICTED: Sus scrofa brefeldin A-inhibited guanine
           nucleotide-exchange protein 2-like (LOC100523411), mRNA
          Length = 1399

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 120

>ref|XM_002912990.1| PREDICTED: Ailuropoda melanoleuca ADP-ribosylation factor guanine
           nucleotide-exchange factor 2 (brefeldin A-inhibited)
           (ARFGEF2), mRNA
          Length = 6451

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 120

>ref|XM_002798127.1| PREDICTED: Macaca mulatta ADP-ribosylation factor guanine
           nucleotide-exchange factor 2 (brefeldin A-inhibited)
           (ARFGEF2), mRNA
          Length = 5801

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 248 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 297

>dbj|AK343304.1| Sus scrofa mRNA, clone:ADR010031D02, expressed in adrenal gland
          Length = 1937

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 242 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 291

>ref|NG_011490.1| Homo sapiens ADP-ribosylation factor guanine nucleotide-exchange
            factor 2 (brefeldin A-inhibited) (ARFGEF2), RefSeqGene on
            chromosome 20
          Length = 121956

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 5223 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 5272

>gb|BC144625.1| Homo sapiens cDNA clone IMAGE:9053156
          Length = 5681

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 134 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 183

>gb|BC144626.1| Homo sapiens cDNA clone IMAGE:9053157
          Length = 6436

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 134 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 183

>ref|NM_006420.2| Homo sapiens ADP-ribosylation factor guanine nucleotide-exchange
           factor 2 (brefeldin A-inhibited) (ARFGEF2), mRNA
          Length = 9004

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 223 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 272

>ref|XM_534448.2| PREDICTED: Canis familiaris similar to Brefeldin A-inhibited
           guanine nucleotide-exchange protein 2 (Brefeldin
           A-inhibited GEP 2) (LOC477256), mRNA
          Length = 6444

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 168 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 217

>gb|BC050449.1| Homo sapiens ADP-ribosylation factor guanine nucleotide-exchange
           factor 2 (brefeldin A-inhibited), mRNA (cDNA clone
           IMAGE:6187759), partial cds
          Length = 2650

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 223 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 272

>emb|AL049537.48| Human DNA sequence from clone RP5-1164I10 on chromosome 20q13.13-13.2
             Contains part of the BIG2 gene for brefeldin A-inhibited
             guanine nucleotide-exchange protein 2, ESTs, STSs, GSSs
             and two CpG islands, complete sequence
          Length = 110028

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1     tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 32460 tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 32509

>gb|AF084521.1|AF084521 Homo sapiens brefeldin A-inhibited guanine nucleotide-exchange
           protein 2 mRNA, complete cds
          Length = 5860

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 120

>ref|XM_002692495.1| PREDICTED: Bos taurus cytohesin 1-like (ARFGEF2), mRNA
          Length = 8868

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 71  tgaagcggcctcagcactcccagctgcgcagggcctgccaggtggcgctc 120

>ref|XM_586261.4| PREDICTED: Bos taurus cytohesin 1-like, transcript variant 1
           (ARFGEF2), mRNA
          Length = 8869

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 71  tgaagcggcctcagcactcccagctgcgcagggcctgccaggtggcgctc 120

>gb|BC158012.1| Mus musculus ADP-ribosylation factor guanine nucleotide-exchange
           factor 2 (brefeldin A-inhibited), mRNA (cDNA clone
           MGC:189963 IMAGE:9088150), complete cds
          Length = 7182

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 200 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 249

>ref|NM_001085495.2| Mus musculus ADP-ribosylation factor guanine nucleotide-exchange
           factor 2 (brefeldin A-inhibited) (Arfgef2), mRNA
          Length = 8777

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 205 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 254

>ref|NM_181083.2| Rattus norvegicus ADP-ribosylation factor guanine
           nucleotide-exchange factor 2 (brefeldin A-inhibited)
           (Arfgef2), mRNA
 gb|AY255526.2| Rattus norvegicus Brefeldin A-inhibited guanine nucleotide-exchange
           factor 2 (Big2) mRNA, complete cds
          Length = 5784

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 71  tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 120

>dbj|AK087920.2| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330040L22
           product:hypothetical protein, full insert sequence
          Length = 2622

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 202 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 251

>dbj|AK153722.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630061I07 product:Similar to
           ADP-ribosylation factor guanine nucleotide-exchange
           factor 2 (Brefeldin A-inhibited) (Fragment) homolog
           [Homo sapiens], full insert sequence
          Length = 2511

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 199 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 248

>dbj|AK087574.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN
           full-length enriched library, clone:E230011G24
           product:unclassifiable, full insert sequence
          Length = 3963

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 209 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 258

>emb|AL591703.14| Mouse DNA sequence from clone RP23-448P12 on chromosome 2 Contains the
             Trp53tk gene for Trp53 regulating kinase, the 5' end of
             the Arfgef2 gene for ADp-ribosylation factor guanine
             nucleotide-exchange factor 2 (brefeldin A-inhibited) and
             two CpG islands, complete sequence
          Length = 89080

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1     tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
             |||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 84550 tgaagcggccccagcactcccagctgcgtagggcctgccaggtggcgctc 84599

>ref|XM_001379067.1| PREDICTED: Monodelphis domestica similar to ADP-ribosylation factor
           guanine nucleotide-exchange factor 2 (brefeldin
           A-inhibited) (LOC100029328), mRNA
          Length = 5535

 Score = 89.7 bits (45), Expect = 1e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

Query: 2   gaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           |||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 72  gaagcggccccagcactcccagctgcgcagagcctgccaggtggcgctc 120

>ref|XM_001916930.1| PREDICTED: Equus caballus ADP-ribosylation factor guanine
           nucleotide-exchange factor 2 (brefeldin A-inhibited)
           (ARFGEF2), mRNA
          Length = 5918

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 49/50 (98%), Gaps = 1/50 (2%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccaggtggcgctc 50
           ||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 206 tgaagcggccccagcactcccagctgcgcagggcctg-caggtggcgctc 254

>ref|XM_001165517.1| PREDICTED: Pan troglodytes ADP-ribosylation factor guanine
           nucleotide-exchange factor 2, transcript variant 1
           (ARFGEF2), mRNA
          Length = 8901

 Score = 73.8 bits (37), Expect = 6e-11
 Identities = 40/41 (97%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccag 41
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctcccag 111

>ref|XM_001165554.1| PREDICTED: Pan troglodytes ADP-ribosylation factor guanine
           nucleotide-exchange factor 2, transcript variant 2
           (ARFGEF2), mRNA
          Length = 8910

 Score = 73.8 bits (37), Expect = 6e-11
 Identities = 40/41 (97%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccag 41
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctcccag 111

>ref|XM_001165620.1| PREDICTED: Pan troglodytes ADP-ribosylation factor guanine
           nucleotide-exchange factor 2, transcript variant 4
           (ARFGEF2), mRNA
          Length = 8859

 Score = 73.8 bits (37), Expect = 6e-11
 Identities = 40/41 (97%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccag 41
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctcccag 111

>ref|XM_001165584.1| PREDICTED: Pan troglodytes ADP-ribosylation factor guanine
           nucleotide-exchange factor 2, transcript variant 3
           (ARFGEF2), mRNA
          Length = 8859

 Score = 73.8 bits (37), Expect = 6e-11
 Identities = 40/41 (97%)
 Strand = Plus / Plus

Query: 1   tgaagcggccccagcactcccagctgcgcagggcctgccag 41
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 71  tgaagcggccccagcactcccagctgcgcagggcctcccag 111


>ref|XM_002830395.1| PREDICTED: Pongo abelii extracellular sulfatase Sulf-2-like
           (LOC100435119), mRNA
          Length = 3969

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 643 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 692

>ref|XM_001106412.2| PREDICTED: Macaca mulatta sulfatase 2 (SULF2), mRNA
          Length = 4648

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 1105 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 1154

>gb|GQ129317.1| Synthetic construct Homo sapiens clone HAIB:100068463;
           DKFZo004B0434 sulfatase 2 protein (SULF2) gene, partial
          Length = 2656

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 197 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 246

>ref|NM_001161841.1| Homo sapiens sulfatase 2 (SULF2), transcript variant 3, mRNA
          Length = 4248

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 844 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 893

>ref|NM_198596.2| Homo sapiens sulfatase 2 (SULF2), transcript variant 2, mRNA
          Length = 4239

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 844 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 893

>ref|NM_018837.3| Homo sapiens sulfatase 2 (SULF2), transcript variant 1, mRNA
          Length = 3909

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 505 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 554

>gb|EU832773.1| Synthetic construct Homo sapiens clone HAIB:100067802;
           DKFZo008B0433 sulfatase 2 protein (SULF2) gene, encodes
           complete protein
          Length = 2656

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 197 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 246

>gb|EU832139.1| Synthetic construct Homo sapiens clone HAIB:100067168;
           DKFZo008E0525 sulfatase 2 protein (SULF2) gene, encodes
           complete protein
          Length = 2656

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 197 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 246

>gb|EU832232.1| Synthetic construct Homo sapiens clone HAIB:100067261;
           DKFZo004E0526 sulfatase 2 protein (SULF2) gene, encodes
           complete protein
          Length = 2656

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 197 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 246

>dbj|AB384154.1| Synthetic construct DNA, clone: pF1KSDA1247, Homo sapiens SULF2
           gene for extracellular sulfatase Sulf-2 precursor,
           complete cds, without stop codon, in Flexi system
          Length = 2651

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 202 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 251

>dbj|AK308829.1| Homo sapiens cDNA, FLJ98870
          Length = 1636

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 496 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 545

>ref|XM_001148908.1| PREDICTED: Pan troglodytes similar to extracellular sulfatase SULF-2
            (LOC744295), mRNA
          Length = 1753

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 1229 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 1278

>ref|NM_001048090.1| Canis lupus familiaris sulfatase 2 (SULF2), mRNA
 tpe|BN000766.1| TPA_inf: Canis familiaris mRNA for sulfatase 2 (sulf2 gene)
          Length = 2610

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 175 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 224

>gb|AY358461.1| Homo sapiens clone DNA48606 GPPS559 (UNQ559) mRNA, complete cds
          Length = 3906

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 782 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 831

>emb|AL354813.31| Human DNA sequence from clone CTD-2653D5 on chromosome 20 Contains part
             of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247), complete sequence
          Length = 93156

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 66552 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 66503

>emb|CR749319.1| Homo sapiens mRNA; cDNA DKFZp313E091 (from clone DKFZp313E091)
          Length = 3945

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 788 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 837

>gb|AY101176.1| Homo sapiens extracellular sulfatase SULF-2 mRNA, complete cds
          Length = 4279

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 844 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 893

>gb|BC110538.1| Homo sapiens cDNA clone IMAGE:40035474, containing frame-shift
          Length = 2838

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 271 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 320

>gb|BC110539.1| Homo sapiens sulfatase 2, mRNA (cDNA clone MGC:126411
           IMAGE:40035480), complete cds
          Length = 2837

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 271 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 320

>dbj|AB033073.2| Homo sapiens mRNA for KIAA1247 protein, partial cds
          Length = 4397

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 50
Sbjct: 505 ggttccatgcaggtgatgaacaagacccggcgcatcatggagcagggcgg 554

>ref|XM_002747629.1| PREDICTED: Callithrix jacchus sulfatase 2 (SULF2), mRNA
          Length = 2601

 Score = 85.7 bits (43), Expect = 2e-14
 Identities = 46/47 (97%)
 Strand = Plus / Plus

Query: 1   ggttccatgcaggtgatgaacaagacccggcgcatcatggagcaggg 47
           |||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 175 ggttccatgcaggtgatgaacaagacccggcgcatcatggcgcaggg 221


chr20 chr20 47538228 47538278 50M                            TCACGTGGTCACGTGACGCGCTCCAACATGGAG
chr20 chr20 47538285 47538335 50M                                                                    GGGGCCGAGGTGTCGCTTCCTGACGGGGCGGCGCGGACGGACGCGGCCCG
chr20 chr20 47538296 47538346 50M                                                                               GTCGCTTCCTGACGGGGCGGCGCGGACGGACGCGGCCGGTGCCGGCCGGC
chr20 chr20 47538304 47538354 50M                                                                                       CTGACGGGGCGGCGCGGACGGACGCGGCCGGTGCCGGCCGGGACGCCGGG
chr20 chr20 47538316 47538366 50M                                                                                                   CGCGGACGGACGCGGCCGGTGCCGGCCGGGACGCCGGGCCCGCAGCCTAG
chr20 chr20 47538321 47538371 50M                                                                                                        ACGGACGCGGCCGGTGCCGGCCGGGACGCCGGGCCCGCAGCCTAGCTCGC
chr20 chr20 47538335 47538385 50M                                                                                                                      TGCCGGCCGGGACGCCGGGCCCGCAGCCTAGCTCGCCATCTCGCTCACGC
chr20 chr20 47538340 47538390 50M                                                                                                                           GCCGGGACGCCGGGCCCGCAGCCTAGCTCGCCATCTCGCTCACGCCGCCC
chr20 chr20 47538347 47538397 50M                                                                                                                                  CGCCGGGCCCGCAGCCTAGCTCGCCATCTCGCTCACGCCGCCCGCCCGCG
chr20 chr20 47538352 47538402 50M                                                                                                                                       GGCCCGCAGCCTAGCTCGCCATCTCGCTCACGCCGCCCGCCCGCGGGGCC
chr20 chr20 47538356 47538406 50M                                                                                                                                           CGCAGCCTAGCTCGCCATCTCGCTCACGCCGCCCGCCCGCGGGGCCGTCA
chr20 chr20 47538363 47538413 50M                                                                                                                                                  TAGCTCGCCATCTCGCTCACGCCGCCCGCCCGCGGGGCCGTCAGCCCCCG
chr20 chr20 47538366 47538416 50M                                                                                                                                                     CTCGCCATCTCGCTCACGCCGCCCGCCCGCGGGGCCGTCAGCCCCCGCCG
chr20 chr20 47538376 47538426 50M                                                                                                                                                               CGCTCACGCCGCCCGCCCGCGGGGCCGTCAGCCCCCGCCGGGCCGGGGCC
chr20 chr20 47538382 47538432 50M                                                                                                                                                                     CGCCGCCCGCCCGCGGGGCCGTCAGCCCCCGCCGGGCCGGGGCCATGCAG
chr20 chr20 47538387 47538437 50M                                                                                                                                                                          CCCGCCCGCGGGGCCGTCAGCCCCCGCCGGGCCGGGGCCATGCAGGAGAG
chr20 chr20 47538391 47538441 50M                                                                                                                                                                              CCCGCGGGGCCGTCAGCCCCCGCCGGGCCGGGGCCATGCAGGAGAGCCAG
chr20 chr20 47538394 47538444 50M                                                                                                                                                                                 GCGGGGCCGTCAGCCCCCGCCGGGCCGGGGCCATGCAGGAGAGCCAGACC
chr20 chr20 47538399 47538449 50M                                                                                                                                                                                      GCCGTCAGCCCCCGCCGGGCCGGGGCCATGCAGGAGAGCCAGACCAAGAG
chr20 chr20 47538404 47538454 50M                                                                                                                                                                                           CAGCCCCCGCCGGGCCGGGGCCATGCAGGAGAGCCAGACCAAGAGCATGT
chr20 chr20 47538411 47538461 50M                                                                                                                                                                                                  CGCCGGGCCGGGGCCATGCAGGAGAGCCAGACCAAGAGCATGTTCGTGTC
chr20 chr20 47538414 47538464 50M                                                                                                                                                                                                     CGGGCCGGGGCCATGCAGGAGAGCCAGACCAAGAGCATGTTCGTGTCCCA
chr20 chr20 47538417 47538467 50M                                                                                                                                                                                                        GCCGGGGCCATGCAGGAGAGCCAGACCAAGAGCATGTTCGTGTCCCGGAC
chr20 chr20 47538424 47538474 50M                                                                                                                                                                                                               CCATGCAGGAGAGCCAGACCAAGAGCATGTTCGTGTCCCGGGCCCTGGAG
chr20 chr20 47538428 47538478 50M                                                                                                                                                                                                                   GCAGGAGAGCCAGACCAAGAGCATGTTCGTGTCCCGGGCCCTGGAGAAGA
chr20 chr20 47538432 47538482 50M                                                                                                                                                                                                                       GAGAGCCAGACCAAGAGCATGTTCGTGTCCCGGGCCCTGGAGAAGATCCT
chr20 chr20 47538442 47538492 50M                                                                                                                                                                                                                                 CCAAGAGCATGTTCGTGTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAG
chr20 chr20 47538445 47538495 50M                                                                                                                                                                                                                                    AGAGCATGTTCGTGTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAGGAG
chr20 chr20 47538448 47538498 50M                                                                                                                                                                                                                                       GCATGTTCGTGTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAGGAGGTG
chr20 chr20 47538451 47538501 50M                                                                                                                                                                                                                                          TGTTCGTGTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAGGAGGTGAAG
chr20 chr20 47538454 47538504 50M                                                                                                                                                                                                                                             TCGTGTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAGGAGGTGAAGCGG
chr20 chr20 47538458 47538508 50M                                                                                                                                                                                                                                                 GTCCCGGGCCCTGGAGAAGATCCTAGCCGACAAGGAGGTGAAGCGGCCCC
chr20 chr20 47538462 47538512 50M                                                                                                                                                                                                                                                     CGGGCCCTGGAGAAGATCCGAGCCGACAAGGAGGGGAAGCGGCCCCAGCA
chr20 chr20 47538466 47538516 50M                                                                                                                                                                                                                                                         CCCTGGAGAAGATCCTAGCCGACAAGGAGGTGAAGCGGCCCCAGCACTCC
chr20 chr20 47538469 47538519 50M                                                                                                                                                                                                                                                            TGGAGAAGATCCTAGCCGACAAGGAGGTGAAGCGGCCCCAGCACTCCCAG
chr20 chr20 47538473 47538523 50M                                                                                                                                                                                                                                                                GAAGATCCTAGCCGACAAGGAGGTGAAGCGGCCCCAGCACTCCCAGCTGC
chr20 chr20 47538480 47538530 50M                                                                                                                                                                                                                                                                       CTAGCCGACAAGGAGGTGAAGCGGCCCCAGCACTCCCAGCTGCGCAGGCC
chr20 chr20 47538483 47538533 50M                                                                                                                                                                                                                                                                          GCCGACAAGGAGGTGAAGCGGCCCCAGCACTCCCAGCTGCGCAGGGCCTG
chr20 chr20 47538488 47538538 50M                                                                                                                                                                                                                                                                               CAAGGAGGTGAAGCGGCCCCAGCACTCCCAGCTGCGCAGGGCCTGCCAGG
chr20 chr20 47538491 47538541 50M                                                                                                                                                                                                                                                                                  GGAGGTGAAGCGGCCCCAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGG
chr20 chr20 47538494 47538544 50M                                                                                                                                                                                                                                                                                     GGTGAAGCGGCCCCAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGC
chr20 chr20 47538499 47538549 50M                                                                                                                                                                                                                                                                                          AGCGGCCCCAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTCGAT
chr20 chr20 47538504 46365678 42M46365686F8m                                                                                                                                                                                                                                                                                    CCCCAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCAT
chr20 chr20 47538506 46365676 40M46365686F10m                                                                                                                                                                                                                                                                                     CCAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGC
chr20 chr20 47538507 46365675 39M46365686F11m                                                                                                                                                                                                                                                                                      CAGCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCA
chr20 chr20 47538509 46365673 37M46365686F13m                                                                                                                                                                                                                                                                                        GCACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGG
chr20 chr20 47538511 46365671 35M46365686F15m                                                                                                                                                                                                                                                                                          ACTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGTAGGTG
chr20 chr20 47538512 46365670 34M46365686F16m                                                                                                                                                                                                                                                                                           CTCCCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGA
chr20 chr20 47538515 46365667 31M46365686F19m                                                                                                                                                                                                                                                                                              CCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGA
chr20 chr20 47538515 46365667 31M46365686F19m                                                                                                                                                                                                                                                                                              CCAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGA
chr20 chr20 47538516 46365666 30M46365686F20m                                                                                                                                                                                                                                                                                               CAGCTGCGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAA
chr20 chr20 47538522 46365660 24M46365686F26m                                                                                                                                                                                                                                                                                                     CGCAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGAC
chr20 chr20 47538524 46365658 22M46365686F28m                                                                                                                                                                                                                                                                                                       CAGGGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCC
chr20 chr20 47538527 46365655 19M46365686F31m                                                                                                                                                                                                                                                                                                          GGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGAC
chr20 chr20 47538527 46365655 19M46365686F31m                                                                                                                                                                                                                                                                                                          GGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGC
chr20 chr20 47538527 46365655 19M46365686F31m                                                                                                                                                                                                                                                                                                          GGCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGC
chr20 chr20 47538528 46365654 18M46365686F32m                                                                                                                                                                                                                                                                                                           GCCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCG
chr20 chr20 47538529 46365653 17M46365686F33m                                                                                                                                                                                                                                                                                                            CCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGC
chr20 chr20 47538529 46365653 17M46365686F33m                                                                                                                                                                                                                                                                                                            CCTGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGC
chr20 chr20 47538531 46365651 15M46365686F35m                                                                                                                                                                                                                                                                                                              TGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCAT
chr20 chr20 47538531 46365651 15M46365686F35m                                                                                                                                                                                                                                                                                                              TGCCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCAT
chr20 chr20 47538533 46365649 13M46365686F37m                                                                                                                                                                                                                                                                                                                CCAGGTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCA
chr20 chr20 47538537 46365645 9M46365686F41m                                                                                                                                                                                                                                                                                                                     GTGGCGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGA
chr20 chr20 47538541 46365641 5M46365686F45m                                                                                                                                                                                                                                                                                                                         CGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAG
chr20 chr20 47538541 46365641 5M46365686F45m                                                                                                                                                                                                                                                                                                                         CGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAG
chr20 chr20 47538541 46365641 5M46365686F45m                                                                                                                                                                                                                                                                                                                         CGCTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGCGCAG
chr20 chr20 47538542 46365640 4M46365686F46m                                                                                                                                                                                                                                                                                                                          GCTG GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGG
chr20 chr20 47538543 46365639 3M46365686F47m                                                                                                                                                                                                                                                                                                                           CTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGG
chr20 chr20 47538543 46365639 3M46365686F47m                                                                                                                                                                                                                                                                                                                           CTC GGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGG
chr20 chr20 46365688 46365638 50m                                                                                                                                                                                                                                                                                                                                        TGGGTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGGC
chr20 chr20 46365685 46365635 50m                                                                                                                                                                                                                                                                                                                                           GTTCCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGGCGGG
chr20 chr20 46365682 46365632 50m                                                                                                                                                                                                                                                                                                                                              CCATGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGGCGGGACG
chr20 chr20 46365679 46365629 50m                                                                                                                                                                                                                                                                                                                                                 TGCAGGTGATGAACAAGACCCGGCGCATCATGGAGCAGGGCGGGACGCAC
chr20 chr20 46365674 46365624 50m                                                                                                                                                                                                                                                                                                                                                      GTGATGAACAAGACCCGGCGCATCATGGAGCAGGGCCGGACGCACTTCAT
chr20 chr20 46365671 46365621 50m                                                                                                                                                                                                                                                                                                                                                         ATGAACAAGACCCGGCGCATCATGGAGCAGGGCGGGACGCACTTCATCAA
chr20 chr20 46365668 46365618 50m                                                                                                                                                                                                                                                                                                                                                            AACAAGACCCGGCGCATCATGGAGCAGGGCGGGACGCACTTCATCAACGC
chr20 chr20 46365665 46365615 50m                                                                                                                                                                                                                                                                                                                                                               AAGACCCGGCGCATCATGGAGCAGGGCGGGACGCACTTCATCAACGCCTT
chr20 chr20 46365662 46365612 50m                                                                                                                                                                                                                                                                                                                                                                  ACCCGGCGCATCATGGAGCAGGGCGGGACGCACTTCATCAACGCCTTCGT
chr20 chr20 46365659 46365609 50m                                                                                                                                                                                                                                                                                                                                                                     CGGCGCATCATGGAGCAGGGCGGGACGCACTTCATCAACGCCTTCGTGAA
chr20 chr20 46365656 46365606 50m                                                                                                                                                                                                                                                                                                                                                                        TGCATCATGGAGCAGGGCGGGACGCACTTCATCAACGCCTTCGTGACCAC
chr20 chr20 46365653 46365603 50m                                                                                                                                                                                                                                                                                                                                                                           ATCATGGAGCAGGGCGGGACGCACTTCATCAACGCCTTCGTGACCACACC
chr20 chr20 46365650 46365600 50m                                                                                                                                                                                                                                                                                                                                                                              ATGGAGCAGGGCGGGACGCACTTCATCAACGCCTTCGTGACCACGCCCAT
chr20 chr20 46365647 46365597 50m                                                                                                                                                                                                                                                                                                                                                                                 GAGCAGGGCGGGACGCACTTCATCAACGCCTTCGTGACCAGACCCATGTG
chr20 chr20 46365644 46365594 50m                                                                                                                                                                                                                                                                                                                                                                                    CAGGGCGGGACGCACTTCATCAACGCCTTCGTGACCACACCCATGTGCTG
chr20 chr20 46365641 46365591 50m                                                                                                                                                                                                                                                                                                                                                                                       GGCGGGACGCACTTCATCAACGCCTTCGTGACCACACCCATGTGCTGCCC
chr20 chr20 46365638 46365588 50m                                                                                                                                                                                                                                                                                                                                                                                          GGGGCGCACTTCATCAACGCCTTCGTGACCACACCCATGTGCTGCCCCCC
chr20 chr20 46365635 46365585 50m                                                                                                                                                                                                                                                                                                                                                                                             ACGCACTTCATCAACGCCTTCGTGACCACACCCATGTGCTGCCCCTCACG
chr20 chr20 46365632 46365582 50m                                                                                                                                                                                                                                                                                                                                                                                                CACTTCATCAACGCCTTCGTGACCACACCCATGTGCTGCCCCTCACGCTC
chr20 chr20 46365628 46365578 50m                                                                                                                                                                                                                                                                                                                                                                                                    TCATCAACGCCTTCGTGACCACACCCATGTGCTGCCCCTCACGCTCCTCC
chr20 chr20 46365625 46365575 50m                                                                                                                                                                                                                                                                                                                                                                                                       TCAACGCCTTCGTGACCACACCCATGTGCTGCCCCTCACGCTCCTCCATC
chr20 chr20 46365621 46365571 50m                                                                                                                                                                                                                                                                                                                                                                                                           CGCCTTCGTGACCACACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCA
chr20 chr20 46365618 46365568 50m                                                                                                                                                                                                                                                                                                                                                                                                              CTTCGTGACCACACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCACCG
chr20 chr20 46365615 46365565 50m                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGACCACACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCA
chr20 chr20 46365612 46365562 50m                                                                                                                                                                                                                                                                                                                                                                                                                    GACCACACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGT
chr20 chr20 46365609 46365559 50m                                                                                                                                                                                                                                                                                                                                                                                                                       CACACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGTACG
chr20 chr20 46365606 46365556 50m                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCATGTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGTACGTCC
chr20 chr20 46365603 46365553 50m                                                                                                                                                                                                                                                                                                                                                                                                                             CATGTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGTACGTCCACA
chr20 chr20 46365600 46365550 50m                                                                                                                                                                                                                                                                                                                                                                                                                                GTGCTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGTACGTCCACAACC
chr20 chr20 46365597 46365547 50m                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCCCCTCACGCTCCTCCATCCTCACCGGCAAGTACGTCCACAACCACA
chr20 chr20 46365593 46365543 50m                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTCCCGCTCCTCCATCCTCACCGGCAAGTACGTCCACAACCACAACAC
chr20 chr20 46365589 46365539 50m                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGCTCCTCCATCCTCACCGGCAAGTACGTCCACAACCACAACACCTAC
chr20 chr20 46365582 46365532 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCATCCTCACCGGCAAGTACGTCCACAACCACAACACCTACACCAACT
chr20 chr20 46365578 46365528 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTCACCGGCAAGTACGTCCACAACCACAACACCTACACCAACAATGA
chr20 chr20 46365575 46365525 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCACCGGCAAGTACGTCCACAACCACAACACCTACACCAACAATGAGAA
chr20 chr20 46365571 46365521 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGCAAGTACGTCCACAACCACAACACCTACACCAACAATGAGAACTGC
chr20 chr20 46365567 46365517 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGTACGTCCACAACCACAACACCTACACCAACCATGAGAACTGCTCCT
chr20 chr20 46365564 46365514 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTACGTCCACAACCACAACACCTACACCAACAATGAGAACTGCTCCTCGC
chr20 chr20 46365560 46365510 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCCACAACCACAACACCTACACCAACAATGAGAACTGCTCCTCGCCCTC
chr20 chr20 46365557 46365507 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAACCACAACACCTACACCAACAATGAGAACTGCTCCTCGCCCTCCTG
chr20 chr20 46365554 46365504 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCACAACACCTACACCAACAATGAGAACTGCTCCTCGCCCTCCTGGCA
chr20 chr20 46365551 46365501 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAACACCTACGCCAACAATGAGAACTGCTCCTCGCCCTCCTGGCAGGC
chr20 chr20 46365548 46365498 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACACCTACACCAACAATGAGAACTGCTCCTCGCCCTCCTGGCAGGCACA
chr20 chr20 46365545 46365495 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTACACTAACAATGAGAACTGCTCCTCGCCCTCCTGGCAGGCACAGCA
chr20 chr20 46365542 46365492 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACACCAACAATGAGAACTGCTCCTCGCCCTCCTGGCAGGCACAGCACGA
chr20 chr20 46365539 46365489 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAACAATGAGAACTGCTCCTCGCCCTCCTGGCGGGCACAGCACGAGAG
chr20 chr20 46365536 46365486 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAATGAGAACTGCTCCTCGCCCTCCTGGCAGGCACAGCACGAGAGCCG
chr20 chr20 46365533 46365483 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGAGAACTGCTCCTCGCCCTCCTGGCAGGCACAGCACGAGAGCCGCAC
chr20 chr20 46365529 46365479 50m                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACTGCTCCTCGCCCTCCTGGCAGGCACAGCACGAGAGCCGCACCTTT

11 pairs


MCF7 chr20-chr20 46415145 52210297 rf

22 18 27 0 37 37
00000000000001112469999999999999999999999999999999 99999999999999999999999999999999887110000000000000
SULF2 exon21(46414790-46415359) ENSG00000171940 exon6(52210293-52210377)

blast search - human genome


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 46415195 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 46415146

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 43156761 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 43156712

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 43128890 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 43128841


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 52210298 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 52210347

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 48956544 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 48956593

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 48914945 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 48914994

>ref|NC_000022.10| Homo sapiens chromosome 22, GRCh37.p2 primary reference assembly
          Length = 51304566

 Score = 83.8 bits (42), Expect = 2e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1        cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
                |||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 17091052 cggctccggcgcctcggccgtttcctcgcgcggcggcggccgggactgag 17091101

>ref|AC_000154.1| Homo sapiens chromosome 22, alternate assembly HuRef, whole genome
              shotgun sequence
          Length = 34107095

 Score = 83.8 bits (42), Expect = 2e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1      cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
              |||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 910510 cggctccggcgcctcggccgtttcctcgcgcggcggcggccgggactgag 910559

>ref|AC_000065.1| Homo sapiens chromosome 22, alternate assembly Hs_Celera, whole genome
              shotgun sequence
          Length = 35075081

 Score = 83.8 bits (42), Expect = 2e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1      cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
              |||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 713203 cggctccggcgcctcggccgtttcctcgcgcggcggcggccgggactgag 713252

blast search - nt


>ref|NM_001161841.1| Homo sapiens sulfatase 2 (SULF2), transcript variant 3, mRNA
          Length = 4248

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 166 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 215

>ref|NM_198596.2| Homo sapiens sulfatase 2 (SULF2), transcript variant 2, mRNA
          Length = 4239

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 166 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 215

>ref|XM_001148908.1| PREDICTED: Pan troglodytes similar to extracellular sulfatase
           SULF-2 (LOC744295), mRNA
          Length = 1753

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 670 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 719

>gb|AY358461.1| Homo sapiens clone DNA48606 GPPS559 (UNQ559) mRNA, complete cds
          Length = 3906

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 104 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 153

>emb|AL121777.39| Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 23004 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 22955

>emb|CR749319.1| Homo sapiens mRNA; cDNA DKFZp313E091 (from clone DKFZp313E091)
          Length = 3945

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 110 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 159

>gb|AY101176.1| Homo sapiens extracellular sulfatase SULF-2 mRNA, complete cds
          Length = 4279

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 50
Sbjct: 166 gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcctg 215

>ref|XM_002830395.1| PREDICTED: Pongo abelii extracellular sulfatase Sulf-2-like
          (LOC100435119), mRNA
          Length = 3969

 Score = 89.7 bits (45), Expect = 1e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

Query: 1  gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 49
          ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 25 gaggctttcagcaaaggcagtcgagtgtttgcagaccggggcgagtcct 73

>ref|XM_001106412.2| PREDICTED: Macaca mulatta sulfatase 2 (SULF2), mRNA
          Length = 4648

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

Query: 1   gaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagt 46
           ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 429 gaggctttcagcaaaggcagtcgagtgtttgcagaccggggcgagt 474


>ref|XM_002830434.1| PREDICTED: Pongo abelii zinc finger protein 217-like
          (LOC100456343), mRNA
          Length = 3924

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1  cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 81 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 32

>emb|AL157838.24| Human DNA sequence from clone RP4-724E16 on chromosome 20q13.12-13.32
             Contains the ZNF217 gene for zinc finger protein 217, a
             novel gene and two CpG islands, complete sequence
          Length = 128871

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1     cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 82195 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 82244

>gb|AF312915.1|AF312915 Homo sapiens chromosome 20 clones 97 and 127, complete sequence
          Length = 121143

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1      cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
Sbjct: 115930 cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 115979

>emb|CR974566.12| Pig DNA sequence from clone CH242-112C22 on chromosome 17, complete
          Length = 164668

 Score = 89.7 bits (45), Expect = 1e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

Query: 1     cggctccggctcctcggccatttcctcgcgcggcggcggccgggactga 49
             ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 25632 cggctccggctcctcggccatttcctcgctcggcggcggccgggactga 25680

>dbj|AP000365.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone:KB7G2
          Length = 111123

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1     cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
             |||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 32439 cggctccggcgcctcggccgtttcctcgcgcggcggcggccgggactgag 32488

>dbj|AP000547.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye Syndrome region,
          Length = 123288

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1      cggctccggctcctcggccatttcctcgcgcggcggcggccgggactgag 50
              |||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 122385 cggctccggcgcctcggccgtttcctcgcgcggcggcggccgggactgag 122434


chr20 chr20 46415363 46415313 50m                                    TCCCGGGCCATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGAG
chr20 chr20 46415360 46415310 50m                                       CGGGCCATTTCTGGACAACGGCTGCTATTTTCACTTGAGCCGAAGTTAAT
chr20 chr20 46415357 46415307 50m                                          GCCATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTC
chr20 chr20 46415354 46415304 50m                                             ATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCG
chr20 chr20 46415351 46415301 50m                                                TCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGG
chr20 chr20 46415346 46415296 50m                                                     ACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTC
chr20 chr20 46415343 46415293 50m                                                        ACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCG
chr20 chr20 46415340 46415290 50m                                                           GCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGAC
chr20 chr20 46415337 46415287 50m                                                              GCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCG
chr20 chr20 46415334 46415284 50m                                                                 ATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCAC
chr20 chr20 46415327 46415277 50m                                                                        CTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGC
chr20 chr20 46415324 46415274 50m                                                                           GAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCG
chr20 chr20 46415321 46415271 50m                                                                              CCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTT
chr20 chr20 46415318 46415268 50m                                                                                 AAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGC
chr20 chr20 46415313 46415263 50m                                                                                      AATTTCTCGGGGAGTTCTCGGGCGCGCACAGACAGCTCGGTTTGCCCTGC
chr20 chr20 46415308 46415258 50m                                                                                           CTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTG
chr20 chr20 46415305 46415255 50m                                                                                              GGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGC
chr20 chr20 46415301 46415251 50m                                                                                                  AGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCG
chr20 chr20 46415297 46415247 50m                                                                                                      CTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTC
chr20 chr20 46415294 46415244 50m                                                                                                         GGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCG
chr20 chr20 46415291 46415241 50m                                                                                                            CGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCC
chr20 chr20 46415288 46415238 50m                                                                                                               GCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGG
chr20 chr20 46415285 46415235 50m                                                                                                                  CAGGCAGCTCGGTTTGCCCTGCAATTGAGCTGCGGGTCGCGGCCGGCGCC
chr20 chr20 46415282 46415232 50m                                                                                                                     GCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGC
chr20 chr20 46415278 46415228 50m                                                                                                                         CTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCT
chr20 chr20 46415274 46415224 50m                                                                                                                             GTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCTC
chr20 chr20 46415271 46415221 50m                                                                                                                                TGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGG
chr20 chr20 46415268 46415218 50m                                                                                                                                   CCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAA
chr20 chr20 46415264 46415214 50m                                                                                                                                       CGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGT
chr20 chr20 46415261 46415211 50m                                                                                                                                          TTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTG
chr20 chr20 46415257 46415207 50m                                                                                                                                              GCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGC
chr20 chr20 46415254 46415204 50m                                                                                                                                                 GCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGG
chr20 chr20 46415251 46415201 50m                                                                                                                                                    GGTCGCGGCCGGCGCCGGCCTCTCCAATAGCAAATGTGTGTGGCTGGAGG
chr20 chr20 46415248 46415198 50m                                                                                                                                                       CGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGA
chr20 chr20 46415245 46415195 50m                                                                                                                                                          GGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCG
chr20 chr20 46415240 46415190 50m                                                                                                                                                               GCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGG
chr20 chr20 46415237 46415187 50m                                                                                                                                                                  CCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTT
chr20 chr20 46415234 46415184 50m                                                                                                                                                                     GCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCG
chr20 chr20 46415230 46415180 50m                                                                                                                                                                         CTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAA
chr20 chr20 46415226 46415176 50m                                                                                                                                                                             AATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGC
chr20 chr20 46415223 46415173 50m                                                                                                                                                                                GGCAAATGTGTGTGGCTGGAGGCGAGCGCGGGGCTTTCGGCAAAGGCAGT
chr20 chr20 46415219 46415169 50m                                                                                                                                                                                    AATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAG
chr20 chr20 46415214 46415164 50m                                                                                                                                                                                         GTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTT
chr20 chr20 46415211 46415161 50m                                                                                                                                                                                            TGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCA
chr20 chr20 46415208 46415158 50m                                                                                                                                                                                               CTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGAC
chr20 chr20 46415205 46415155 50m                                                                                                                                                                                                  GAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGG
chr20 chr20 46415202 46415152 50m                                                                                                                                                                                                     GCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGC
chr20 chr20 46415199 46415149 50m                                                                                                                                                                                                        AGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAG
chr20 chr20 46415196 46415146 50m                                                                                                                                                                                                           GCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCC
chr20 chr20 46415193 46415143 50m                                                                                                                                                                                                              AGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTCG
chr20 chr20 46415181 52210310 37m52210298F13M                                                                                                                                                                                                              AAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCC
chr20 chr20 46415178 52210313 34m52210298F16M                                                                                                                                                                                                                 GCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCG
chr20 chr20 46415177 52210314 33m52210298F17M                                                                                                                                                                                                                  CAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGG
chr20 chr20 46415177 52210314 33m52210298F17M                                                                                                                                                                                                                  CAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGG
chr20 chr20 46415176 52210315 32m52210298F18M                                                                                                                                                                                                                   AGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGC
chr20 chr20 46415176 52210315 32m52210298F18M                                                                                                                                                                                                                   AGTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGC
chr20 chr20 46415175 52210316 31m52210298F19M                                                                                                                                                                                                                    GTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCC
chr20 chr20 46415175 52210316 31m52210298F19M                                                                                                                                                                                                                    GTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCC
chr20 chr20 46415175 52210316 31m52210298F19M                                                                                                                                                                                                                    GTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCC
chr20 chr20 46415175 52210316 31m52210298F19M                                                                                                                                                                                                                    GTCGAGTGTTTGCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCC
chr20 chr20 46415167 52210324 23m52210298F27M                                                                                                                                                                                                                            TTTGCAGACCGGGGCGAGTCGTG CGGCTCCGGCTCCTCGGCCATTTCCAC
chr20 chr20 46415164 52210327 20m52210298F30M                                                                                                                                                                                                                               GCAGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCG
chr20 chr20 46415162 52210329 18m52210298F32M                                                                                                                                                                                                                                 AGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCG
chr20 chr20 46415162 52210329 18m52210298F32M                                                                                                                                                                                                                                 AGACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCG
chr20 chr20 46415160 52210331 16m52210298F34M                                                                                                                                                                                                                                   ACCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGC
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCG
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCG
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCG
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCG
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCT
chr20 chr20 46415159 52210332 15m52210298F35M                                                                                                                                                                                                                                    CCGGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCG
chr20 chr20 46415157 52210334 13m52210298F37M                                                                                                                                                                                                                                      GGGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGC
chr20 chr20 46415156 52210335 12m52210298F38M                                                                                                                                                                                                                                       GGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCG
chr20 chr20 46415156 52210335 12m52210298F38M                                                                                                                                                                                                                                       GGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGCAGGCG
chr20 chr20 46415156 52210335 12m52210298F38M                                                                                                                                                                                                                                       GGGCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCG
chr20 chr20 46415156 52210335 12m52210298F38M                                                                                                                                                                                                                                       GGGCTAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCG
chr20 chr20 46415154 52210337 10m52210298F40M                                                                                                                                                                                                                                         GCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGC
chr20 chr20 46415154 52210337 10m52210298F40M                                                                                                                                                                                                                                         GCGAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGC
chr20 chr20 46415152 52210339 8m52210298F42M                                                                                                                                                                                                                                            GAGTCCTG CGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGCCG
chr20 chr20 52210293 52210343 50M                                                                                                                                                                                                                                                            CCTGCGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGCCGGGAC
chr20 chr20 52210296 52210346 50M                                                                                                                                                                                                                                                               GCGGCTCCGGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGCCGGGACTGA
chr20 chr20 52210299 52210349 50M                                                                                                                                                                                                                                                                  GCTCCAGCTCCTCGGCCATTTCCTCGCGCGGCGGCGGCCGGGACTGAGCT
chr20 chr20 52210302 52210352 50M                                                                                                                                                                                                                                                                     CCGGCTCCTCGGCCACTTCCTCGCGCGGCGGCGGCCGGGACTGAGCTGAC
chr20 chr20 52210307 52210357 50M                                                                                                                                                                                                                                                                          TCCTCGGCCATTTCCTCGCGCGGCGGCGGCCGGGACTGAGCTGATACCAC
chr20 chr20 52210310 52210360 50M                                                                                                                                                                                                                                                                             TCGGCCATTTCCTCGCGCGGCGGCNGCCGGGACTGAGCTGACACGACTCG
chr20 chr20 52210316 52210366 50M                                                                                                                                                                                                                                                                                   ATTTCCTCGCGCGGCGGCGGCCGGGACTGAGCTGACACCACTCGGGCCGG
chr20 chr20 52210343 52210393 50M                                                                                                                                                                                                                                                                                                              TGAGCTGACACCACTCGGGCCGGCCGGGTTTGAATGAGGAGGAGCGGGCG
chr20 chr20 52210353 52210403 50M                                                                                                                                                                                                                                                                                                                        CCACTCGGGCCGGCCGGGTTTGAATGAGGAGGAGCGGGCGCGGAGGGGAG
chr20 chr20 52210360 52210410 50M                                                                                                                                                                                                                                                                                                                               GGCCGGCCGGGTTTGAATGAGGAGGAGCGGGAGCGGAGGGGAGGGGGCGG
chr20 chr20 52210418 52210468 50M                                                                                                                                                                                                                                                                                                                                                                                         GAGGGAGGGAGGGAGGCGTCGCGGAGTTTCTCTCAGCCTTTTGTGCGGCA
chr20 chr20 52210464 52210514 50M                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACACCTCCCGGATTCCGCGCCCGCACCCGGCCCCCCAAAAGACACGGG
chr20 chr20 52210562 52210612 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGCCTCCAAGACCCCCCCCCAACAAAAAAGG

18 pairs


MCF7 chr20-chr20 46415146 52210647 rf

11 18 14 0 34 36
00000000000000001111333888888889999999999999999999 99999999999999999999888333333332221100000000000000
SULF2 exon21(46414790-46415359) ENSG00000171940 exon5(52210644-52210800)

blast search - human genome


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 46415196 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 46415147

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 43156762 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 43156713

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 43128891 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 43128842


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 50
Sbjct: 52210648 cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 52210697

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 50
Sbjct: 48956894 cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 48956943

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 50
Sbjct: 48915295 cgggcgcggggctaaggtgagcggggcgggggtgcgcacgggggcaaagg 48915344

blast search - nt


>ref|NM_001161841.1| Homo sapiens sulfatase 2 (SULF2), transcript variant 3, mRNA
          Length = 4248

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 165 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 214

>ref|NM_198596.2| Homo sapiens sulfatase 2 (SULF2), transcript variant 2, mRNA
          Length = 4239

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 165 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 214

>ref|XM_001148908.1| PREDICTED: Pan troglodytes similar to extracellular sulfatase
           SULF-2 (LOC744295), mRNA
          Length = 1753

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 669 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 718

>gb|AY358461.1| Homo sapiens clone DNA48606 GPPS559 (UNQ559) mRNA, complete cds
          Length = 3906

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 103 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 152

>emb|AL121777.39| Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 23005 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 22956

>emb|CR749319.1| Homo sapiens mRNA; cDNA DKFZp313E091 (from clone DKFZp313E091)
          Length = 3945

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 109 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 158

>gb|AY101176.1| Homo sapiens extracellular sulfatase SULF-2 mRNA, complete cds
          Length = 4279

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
Sbjct: 165 cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 214

>ref|XM_002830395.1| PREDICTED: Pongo abelii extracellular sulfatase Sulf-2-like
          (LOC100435119), mRNA
          Length = 3969

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1  cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagtcct 50
          |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 24 cgaggctttcagcaaaggcagtcgagtgtttgcagaccggggcgagtcct 73

>ref|XM_001106412.2| PREDICTED: Macaca mulatta sulfatase 2 (SULF2), mRNA
          Length = 4648

 Score = 85.7 bits (43), Expect = 2e-14
 Identities = 46/47 (97%)
 Strand = Plus / Plus

Query: 1   cgaggctttcggcaaaggcagtcgagtgtttgcagaccggggcgagt 47
           |||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 428 cgaggctttcagcaaaggcagtcgagtgtttgcagaccggggcgagt 474


>ref|XM_001092414.2| PREDICTED: Macaca mulatta zinc finger protein 217 (ZNF217), mRNA
          Length = 5873

 Score = 87.7 bits (44), Expect = 4e-15
 Identities = 44/44 (100%)
 Strand = Plus / Minus

Query: 1   cgggcgcggggctaaggtgagcggggcgggggtgcgcacggggg 44
Sbjct: 155 cgggcgcggggctaaggtgagcggggcgggggtgcgcacggggg 112


chr20 chr20 46415363 46415313 50m                                    TCCCGGGCCATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGAG
chr20 chr20 46415360 46415310 50m                                       CGGGCCATTTCTGGACAACGGCTGCTATTTTCACTTGAGCCGAAGTTAAT
chr20 chr20 46415357 46415307 50m                                          GCCATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTC
chr20 chr20 46415354 46415304 50m                                             ATTTCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCG
chr20 chr20 46415351 46415301 50m                                                TCTGGACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGG
chr20 chr20 46415346 46415296 50m                                                     ACAACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTC
chr20 chr20 46415343 46415293 50m                                                        ACAGCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCG
chr20 chr20 46415340 46415290 50m                                                           GCTGCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGAC
chr20 chr20 46415337 46415287 50m                                                              GCTATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCG
chr20 chr20 46415334 46415284 50m                                                                 ATTTTCACTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCAC
chr20 chr20 46415327 46415277 50m                                                                        CTTGAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGC
chr20 chr20 46415324 46415274 50m                                                                           GAGCCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCG
chr20 chr20 46415321 46415271 50m                                                                              CCGAAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTT
chr20 chr20 46415318 46415268 50m                                                                                 AAGTTAATTTCTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGC
chr20 chr20 46415313 46415263 50m                                                                                      AATTTCTCGGGGAGTTCTCGGGCGCGCACAGACAGCTCGGTTTGCCCTGC
chr20 chr20 46415308 46415258 50m                                                                                           CTCGGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTG
chr20 chr20 46415305 46415255 50m                                                                                              GGGGAGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGC
chr20 chr20 46415301 46415251 50m                                                                                                  AGTTCTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCG
chr20 chr20 46415297 46415247 50m                                                                                                      CTCGGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTC
chr20 chr20 46415294 46415244 50m                                                                                                         GGGCGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCG
chr20 chr20 46415291 46415241 50m                                                                                                            CGCGCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCC
chr20 chr20 46415288 46415238 50m                                                                                                               GCACAGGCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGG
chr20 chr20 46415285 46415235 50m                                                                                                                  CAGGCAGCTCGGTTTGCCCTGCAATTGAGCTGCGGGTCGCGGCCGGCGCC
chr20 chr20 46415282 46415232 50m                                                                                                                     GCAGCTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGC
chr20 chr20 46415278 46415228 50m                                                                                                                         CTCGGTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCT
chr20 chr20 46415274 46415224 50m                                                                                                                             GTTTGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCTC
chr20 chr20 46415271 46415221 50m                                                                                                                                TGCCCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGG
chr20 chr20 46415268 46415218 50m                                                                                                                                   CCTGCGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAA
chr20 chr20 46415264 46415214 50m                                                                                                                                       CGATTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGT
chr20 chr20 46415261 46415211 50m                                                                                                                                          TTGAGCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTG
chr20 chr20 46415257 46415207 50m                                                                                                                                              GCTGCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGC
chr20 chr20 46415254 46415204 50m                                                                                                                                                 GCGGGTCGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGG
chr20 chr20 46415251 46415201 50m                                                                                                                                                    GGTCGCGGCCGGCGCCGGCCTCTCCAATAGCAAATGTGTGTGGCTGGAGG
chr20 chr20 46415248 46415198 50m                                                                                                                                                       CGCGGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGA
chr20 chr20 46415245 46415195 50m                                                                                                                                                          GGCCGGCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCG
chr20 chr20 46415240 46415190 50m                                                                                                                                                               GCGCCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGG
chr20 chr20 46415237 46415187 50m                                                                                                                                                                  CCGGCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTT
chr20 chr20 46415234 46415184 50m                                                                                                                                                                     GCCTCTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCG
chr20 chr20 46415230 46415180 50m                                                                                                                                                                         CTCCAATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAA
chr20 chr20 46415226 46415176 50m                                                                                                                                                                             AATGGCAAATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGC
chr20 chr20 46415223 46415173 50m                                                                                                                                                                                GGCAAATGTGTGTGGCTGGAGGCGAGCGCGGGGCTTTCGGCAAAGGCAGT
chr20 chr20 46415219 46415169 50m                                                                                                                                                                                    AATGTGTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAG
chr20 chr20 46415214 46415164 50m                                                                                                                                                                                         GTGTGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTT
chr20 chr20 46415211 46415161 50m                                                                                                                                                                                            TGGCTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCA
chr20 chr20 46415208 46415158 50m                                                                                                                                                                                               CTGGAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGAC
chr20 chr20 46415205 46415155 50m                                                                                                                                                                                                  GAGGCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGG
chr20 chr20 46415202 46415152 50m                                                                                                                                                                                                     GCGAGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGC
chr20 chr20 46415199 46415149 50m                                                                                                                                                                                                        AGCGCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAG
chr20 chr20 46415196 46415146 50m                                                                                                                                                                                                           GCGAGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCC
chr20 chr20 46415193 46415143 50m                                                                                                                                                                                                              AGGCTTTCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCTCG
chr20 chr20 46415187 52210655 42m52210648F8M                                                                                                                                                                                                         TCGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCG
chr20 chr20 46415186 52210656 41m52210648F9M                                                                                                                                                                                                          CGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGG
chr20 chr20 46415186 52210656 41m52210648F9M                                                                                                                                                                                                          CGGCAAAGGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGG
chr20 chr20 46415179 52210663 34m52210648F16M                                                                                                                                                                                                                GGCAGTCGAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAG
chr20 chr20 46415175 52210667 30m52210648F20M                                                                                                                                                                                                                    GTCGGGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGA
chr20 chr20 46415175 52210667 30m52210648F20M                                                                                                                                                                                                                    GTCGAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGA
chr20 chr20 46415172 52210670 27m52210648F23M                                                                                                                                                                                                                       GAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCG
chr20 chr20 46415172 52210670 27m52210648F23M                                                                                                                                                                                                                       GAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCG
chr20 chr20 46415172 52210670 27m52210648F23M                                                                                                                                                                                                                       GAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCG
chr20 chr20 46415172 52210670 27m52210648F23M                                                                                                                                                                                                                       GAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCG
chr20 chr20 46415172 52210670 27m52210648F23M                                                                                                                                                                                                                       GAGTGTTTGCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCG
chr20 chr20 46415164 52210678 19m52210648F31M                                                                                                                                                                                                                               GCAGACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGG
chr20 chr20 46415161 52210681 16m52210648F34M                                                                                                                                                                                                                                  GACCGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTG
chr20 chr20 46415159 52210683 14m52210648F36M                                                                                                                                                                                                                                    CTGGGGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCG
chr20 chr20 46415155 52210687 10m52210648F40M                                                                                                                                                                                                                                        GGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACG
chr20 chr20 46415155 52210687 10m52210648F40M                                                                                                                                                                                                                                        GGCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACG
chr20 chr20 46415154 52210688 9m52210648F41M                                                                                                                                                                                                                                          GCGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACGG
chr20 chr20 46415153 52210689 8m52210648F42M                                                                                                                                                                                                                                           CGAGTCCT CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACGGG
chr20 chr20 52210642 52210692 50M                                                                                                                                                                                                                                                          GTCCTCGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACGGGGGC
chr20 chr20 52210647 52210697 50M                                                                                                                                                                                                                                                               CGGGCGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACGGGGGCAAAGG
chr20 chr20 52210651 52210701 50M                                                                                                                                                                                                                                                                   CGCGGGGCTAAGGTGAGCGGGGCGGGGGTGCGCACGGGGGCAAAGGCGCG
chr20 chr20 52210655 52210705 50M                                                                                                                                                                                                                                                                       GGGCTAAGGTGAGCGGGGCGGGGGTGTGCACGGGGGCAAAGGCGCGGGCG
chr20 chr20 52210668 52210718 50M                                                                                                                                                                                                                                                                                    CGGGCCGGTGGTGCGCACGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTC
chr20 chr20 52210671 52210721 50M                                                                                                                                                                                                                                                                                       GGCGGGGGTGCGCACGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGC
chr20 chr20 52210674 52210724 50M                                                                                                                                                                                                                                                                                          GGGGGTGCGCACGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCG
chr20 chr20 52210678 52210728 50M                                                                                                                                                                                                                                                                                              GTGCGCACGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGA
chr20 chr20 52210681 52210731 50M                                                                                                                                                                                                                                                                                                 CGCATGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGACAG
chr20 chr20 52210684 52210734 50M                                                                                                                                                                                                                                                                                                    ACGGGGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGACAGTGC
chr20 chr20 52210688 52210738 50M                                                                                                                                                                                                                                                                                                        GGGCAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGACAGTGCAGGC
chr20 chr20 52210691 52210741 50M                                                                                                                                                                                                                                                                                                           CAAAGGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGACACTGCAGGCGCG
chr20 chr20 52210695 52210745 50M                                                                                                                                                                                                                                                                                                               GGCGCGGGCGCCCCCTACTCGTCCGCGCGGGGACAGTGCAGGCGCGGGGG
chr20 chr20 52210700 52210750 50M                                                                                                                                                                                                                                                                                                                    GGGCGCCCCCTACTCGTCCGCGCGGGGACAGTGCAGGCGCGGGGGGTCCC
chr20 chr20 52210704 52210754 50M                                                                                                                                                                                                                                                                                                                        GCCCCCTACTCGTCCGCGCGGGGACAGTGCAGGCGCGGGCGGTCCCTAGC
chr20 chr20 52210710 52210760 50M                                                                                                                                                                                                                                                                                                                              TACTCGTCCGCGCGGGGACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCC
chr20 chr20 52210713 52210763 50M                                                                                                                                                                                                                                                                                                                                 TCGTCCGCGCGGGGACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCCGGG
chr20 chr20 52210716 52210766 50M                                                                                                                                                                                                                                                                                                                                    TCCGCGCGGGGACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCCGGGGCG
chr20 chr20 52210721 52210771 50M                                                                                                                                                                                                                                                                                                                                         GCGGGGACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCCGGGGCGCGGCG
chr20 chr20 52210724 52210774 50M                                                                                                                                                                                                                                                                                                                                            GGGACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCCGGGGCGCGGCGCGT
chr20 chr20 52210727 52210777 50M                                                                                                                                                                                                                                                                                                                                               ACAGTGCAGGCGCGGGGGGTCCCTAGAGCCGCCGGGGCGCGGCGCGTCCG
chr20 chr20 52210734 52210784 50M                                                                                                                                                                                                                                                                                                                                                      AGGCGCGGGGGGTCCCTAGAGCCGCCGGGGCGCGGCGCGTCCGGCGCTGG
chr20 chr20 52210741 52210791 50M                                                                                                                                                                                                                                                                                                                                                             GGGGGTCCCTAGAGCCGCCGGGGCGCGGCGCGTCCGGCGCTGGGGGACTG
chr20 chr20 52210744 52210794 50M                                                                                                                                                                                                                                                                                                                                                                GGTCCCTAGAGCCGCCGGGGCGCGGCGCGTCCGGCGCTGGGGGACTGTTG
chr20 chr20 52210754 52210804 50M                                                                                                                                                                                                                                                                                                                                                                          GCCGCCGGGGCGCGGCGCGTCCGGCGCTGGGGGACTGTTGGGTCAGAAAG
chr20 chr20 52210768 52210818 50M                                                                                                                                                                                                                                                                                                                                                                                        GCGCGTCCGGCGCTGGGGGACTGTTGGGTCAGAAAGTGTTCAGGGAGCAG
chr20 chr20 52210771 52210821 50M                                                                                                                                                                                                                                                                                                                                                                                           CGTCCGGCGCTGGGGGACTGTTGGGTCAGAAAGTGTTCAGGGAGCAGCTG
chr20 chr20 52210780 52210830 50M                                                                                                                                                                                                                                                                                                                                                                                                    CTGGGGGACTGTTGGGTCAGAAAGTGTTCAGGGAGCAGCTGTTGCGCCCT
chr20 chr20 52210783 52210833 50M                                                                                                                                                                                                                                                                                                                                                                                                       GGGGACTGTTGGGTCAGAAAGTGTTCAGGGAGCAGCTGTTGCGCCCTCCC
chr20 chr20 52210796 52210846 50M                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAAAGTGTTCAGGGAGCAGCTGTTGCGCCCTCCCTCGGCCCCGCCGC
chr20 chr20 52210810 52210860 50M                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGCAGCTGTTGCGCCCTCCCTCGGCCCCGCCGCTCGGAGACGCCCCG
chr20 chr20 52210818 52210868 50M                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTTGCGCCCTCCCTCGGCCCCGCCGCTCGGAGACGCCCCGCCCCCCCC

18 pairs


MCF7 chr20-chr17 49411707 59430946 ff

9 3 9 0 35 33
00000000000000011111111124888888899999999999999999 99999999999999988888888875111111100000000000000000
BCAS4 exon1(49411465-49411709) BCAS3 intron23(59161925-59445685)

blast search - human genome


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 49411659 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 49411708

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 46160015 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 46160064

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 46115926 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 46115975


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 50
Sbjct: 59430947 aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 59430996

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 50
Sbjct: 54800588 aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 54800637

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 50
Sbjct: 58531995 aggggtgttgtgaggattcatggagcaaatggctgtgaaagcaccttgta 58532044

blast search - nt


>ref|XM_001168029.1| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 1 (BCAS4), mRNA
          Length = 1697

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|XM_001168054.1| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 2 (BCAS4), mRNA
          Length = 1965

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 278

>ref|XM_514721.2| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 3 (BCAS4), mRNA
          Length = 1832

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>gb|BC047337.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone IMAGE:5500336), partial cds
          Length = 1256

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 58  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 107

>gb|BC056883.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone IMAGE:5764497), partial cds
          Length = 1524

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 52  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 101

>gb|AF361220.1| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4) mRNA,
           complete cds
          Length = 968

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 278

>ref|NM_198799.2| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 2, mRNA
          Length = 1271

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|NM_017843.3| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 1, mRNA
          Length = 1368

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|NM_001010974.1| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 3, mRNA
          Length = 1136

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>emb|AL031680.20| Human DNA sequence from clone RP5-850H21 on chromosome 20q13.11-13.2
             Contains the the PARD6B gene for par-6 partitioning
             defective 6 homolog beta (C. elegans), the BCAS4 gene for
             breast carcinoma amplified sequence 4 and two CpG islands,
             complete sequence
          Length = 117431

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1     cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 77084 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 77133

>dbj|AK000502.1| Homo sapiens cDNA FLJ20495 fis, clone KAT08572
          Length = 831

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 92  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 141

>emb|AJ511266.1| Homo sapiens partial mRNA for breast carcinoma amplified sequence 4
           protein (BCAS4 gene), isoform 1
          Length = 365

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 53  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 102

>gb|BC038381.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone MGC:21149 IMAGE:4472674), complete cds
          Length = 1180

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 79  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 128

>gb|AF361221.1| Homo sapiens breast carcinoma amplified sequence 4/3 fusion protein
           (BCAS4/BCAS3 fusion) mRNA, complete cds
          Length = 1321

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           ||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgatcctggggccg 278

>ref|XM_002722695.1| PREDICTED: Oryctolagus cuniculus breast carcinoma amplified
           sequence 4 (LOC100354578), mRNA
          Length = 594

 Score = 87.7 bits (44), Expect = 4e-15
 Identities = 47/48 (97%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggc 48
           |||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 129 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcccggggc 176

>ref|XR_011531.2| PREDICTED: Macaca mulatta breast carcinoma-amplified sequence
           4-like (LOC706118), miscRNA
          Length = 624

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 141 cagcggagcgcgggagctcgcgctcttcctgacccccgagcctggggccg 190

>ref|XM_001095529.2| PREDICTED: Macaca mulatta breast carcinoma amplified sequence 4,
           transcript variant 2 (BCAS4), mRNA
          Length = 734

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 187 cagcggagcgcgggagctcgcgctcttcctgacccccgagcctggggccg 236

>ref|XM_002747669.1| PREDICTED: Callithrix jacchus breast carcinoma-amplified sequence
           4-like (LOC100388541), mRNA
          Length = 612

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 129 cagcggagcgcgcgagctcgccctcttcctgacccccgagcctggggccg 178

>ref|XM_849115.1| PREDICTED: Canis familiaris similar to breast carcinoma amplified
           sequence 4 isoform b (LOC611448), mRNA
          Length = 930

 Score = 79.8 bits (40), Expect = 1e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggc 48
           |||||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 261 cagcggggcgcgcgagctcgcgctcttcctgaccccggagcccggggc 308



chr20 chr20 49411498 49411548 50M                            CTGCCCCGCCTCCGCCAGGCGGTCCGCGGGGCATGCAGCGGACCGGGGGC
chr20 chr20 49411512 49411562 50M                                          CCAGGCGGTCCGCGGGGCATGCAGCCGACCGGGGGGGGGGCTCCGAGGCC
chr20 chr20 49411532 49411582 50M                                                              GCAGCGGACCGGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCC
chr20 chr20 49411535 49411585 50M                                                                 GCGGACCGGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAG
chr20 chr20 49411542 49411592 50M                                                                        GGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCT
chr20 chr20 49411548 49411598 50M                                                                              GGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCA
chr20 chr20 49411554 49411604 50M                                                                                    CCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGA
chr20 chr20 49411560 49411610 50M                                                                                          CCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGT
chr20 chr20 49411564 49411614 50M                                                                                              GGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCC
chr20 chr20 49411567 49411617 50M                                                                                                 GCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTC
chr20 chr20 49411570 49411620 50M                                                                                                    ACCATGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTG
chr20 chr20 49411573 49411623 50M                                                                                                       ACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATG
chr20 chr20 49411576 49411626 50M                                                                                                          GGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTG
chr20 chr20 49411580 49411630 50M                                                                                                              GCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCG
chr20 chr20 49411583 49411633 50M                                                                                                                 AGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCATGG
chr20 chr20 49411587 49411637 50M                                                                                                                     AGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGC
chr20 chr20 49411590 49411640 50M                                                                                                                        CTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGA
chr20 chr20 49411593 49411643 50M                                                                                                                           CGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCA
chr20 chr20 49411596 49411646 50M                                                                                                                              CAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCC
chr20 chr20 49411599 49411649 50M                                                                                                                                 CCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGG
chr20 chr20 49411602 49411652 50M                                                                                                                                    GACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCC
chr20 chr20 49411605 49411655 50M                                                                                                                                       CCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCGA
chr20 chr20 49411608 49411658 50M                                                                                                                                          GTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCG
chr20 chr20 49411611 49411661 50M                                                                                                                                             GCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAG
chr20 chr20 49411614 49411664 50M                                                                                                                                                CTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGG
chr20 chr20 49411617 49411667 50M                                                                                                                                                   CTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGC
chr20 chr20 49411620 49411670 50M                                                                                                                                                      ATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCG
chr20 chr20 49411623 49411673 50M                                                                                                                                                         CTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGA
chr20 chr20 49411626 49411676 50M                                                                                                                                                            CTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCT
chr20 chr20 49411629 49411679 50M                                                                                                                                                               GTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGC
chr20 chr20 49411632 49411682 50M                                                                                                                                                                  GACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCT
chr20 chr20 49411635 49411685 50M                                                                                                                                                                     GCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTT
chr20 chr20 49411638 49411688 50M                                                                                                                                                                        GATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCT
chr20 chr20 49411641 49411691 50M                                                                                                                                                                           CAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGAC
chr20 chr20 49411644 49411694 50M                                                                                                                                                                              CCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCC
chr20 chr20 49411647 49411697 50M                                                                                                                                                                                 GAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGG
chr20 chr20 49411650 49411700 50M                                                                                                                                                                                    CCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCC
chr20 chr20 49411653 49411703 50M                                                                                                                                                                                       ATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGG
chr20 chr20 49411656 49411706 50M                                                                                                                                                                                          CGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGC
chr20 chr20 49411659 49411709 50M                                                                                                                                                                                             AGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCGA
chr20 chr20 49411663 49411713 50M                                                                                                                                                                                                 GGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCGAGGTA
chr20 chr17 49411673 59430961 35M59430947F15M                                                                                                                                                                                               GCTCGCGCTCTTCCGGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGG
chr20 chr17 49411682 59430970 26M59430947F24M                                                                                                                                                                                                        CTTCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGA
chr20 chr17 49411683 59430971 25M59430947F25M                                                                                                                                                                                                         TTCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAG
chr20 chr17 49411683 59430971 25M59430947F25M                                                                                                                                                                                                         TTCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAG
chr20 chr17 49411684 59430972 24M59430947F26M                                                                                                                                                                                                          TCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAGC
chr20 chr17 49411684 59430972 24M59430947F26M                                                                                                                                                                                                          TCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAGC
chr20 chr17 49411684 59430972 24M59430947F26M                                                                                                                                                                                                          TCCTGACCCCCGATCCGGGGGCCG AGGGGTGTTGTGAGGATTCATGGAGC
chr20 chr17 49411684 59430972 24M59430947F26M                                                                                                                                                                                                          TCCTGACCCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAGC
chr20 chr17 49411691 59430979 17M59430947F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGGGTGTTGTGAGGATTCATGGAGCAAATGGC
chr17 chr17 59430945 59430995 50M                                                                                                                                                                                                                                              CGGGGGTGTTGTGAGGATTCATGGAGCAAATGGCTGTGAAAGCACCTTGT
chr17 chr17 59430955 59431005 50M                                                                                                                                                                                                                                                        GTGAGGATTCATGGAGCAAATGGCTGTGAAAGCACCTTGTAAAGGGTAGA
chr17 chr17 59430973 59431023 50M                                                                                                                                                                                                                                                                          AATGGCTGTGAAAGCACCTTGTAAAGGGTAGAGCAGTGTGCGGCGTGAGG
chr17 chr17 59430986 59431036 50M                                                                                                                                                                                                                                                                                       GCACCTTGTAAAGGGTAGAGCAGTGTGCGGCGTGAGGGATTATTATCATT
chr17 chr17 59431005 59431055 50M                                                                                                                                                                                                                                                                                                          GCAGTGTGCGGCGTGAGGGATTATTATCATTGTTAAGACGTCTACGCCTC
chr17 chr17 59431011 59431061 50M                                                                                                                                                                                                                                                                                                                GGCGGCGTGAGGGATTATTATCATTGTTAAGACGTCTACGCCTCGTTGCT
chr17 chr17 59431022 59431072 50M                                                                                                                                                                                                                                                                                                                           GGATTATTATCATTGTTAAGACGTCTACGCCTCGTTGCTCACCCTGTGTG
chr17 chr17 59431028 59431078 50M                                                                                                                                                                                                                                                                                                                                 TTATCATTGTTAAGACGTCTACGCCTCGTTGCTCACCCTGTGTGATCCTG
chr17 chr17 59431045 59431095 50M                                                                                                                                                                                                                                                                                                                                                  TCTACGCCTCGTTGCTCACCCTGTGTGATCCTGCAGCTTCTCAACTTTTC
chr17 chr17 59431049 59431099 50M                                                                                                                                                                                                                                                                                                                                                      CGCCTCGTTGCTCACCCTGTGTGATCCTGCAGCTTCTCAACTTTTCCCTC
chr17 chr17 59431056 59431106 50M                                                                                                                                                                                                                                                                                                                                                             TTGCTCACCCTGTGTGATCCTGCAGCTTCTCAACTTTTCCCTCCTTTCCC
chr17 chr17 59431059 59431109 50M                                                                                                                                                                                                                                                                                                                                                                CTCACCCTGTGTGATCCTGCAGCTTCTCAACTTTTCCCTCCTTTCTCCCG
chr17 chr17 59431073 59431123 50M                                                                                                                                                                                                                                                                                                                                                                              TCCTGCAGCTTCTCAACTTTTCCCTCCTTTCTCCCTGGTTTCCACGCCCG
chr17 chr17 59431077 59431127 50M                                                                                                                                                                                                                                                                                                                                                                                  GCAGCTTCTCAACTTTTCCCTCCTTTCTCCCTGGTTTCCACGCCTGGGCT
chr17 chr17 59431086 59431136 50M                                                                                                                                                                                                                                                                                                                                                                                           CAACTTTTCCCTCCTTTCTCCCTGGTTTCCACGCCTGGGCTGCTGAGTCA
chr17 chr17 59431089 59431139 50M                                                                                                                                                                                                                                                                                                                                                                                              CTTTTCCCTCCTTTCTCCCTGGTTTCCACGCCTGGGCTGCTGAGTCAGGC
chr17 chr17 59431106 59431156 50M                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGTTTCCACGCCTGGGCTGCTGAGTCAGGCGGACCGGCCAAGGCTGG
chr17 chr17 59431115 59431165 50M                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCCTGGGCTGCTGAGTCAGGCGGACCGGCCAAGGCTGGCGAGGGCTG
chr17 chr17 59431124 59431174 50M                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGCTGAGTCAGGCGGACCGGCCAAGGCTGGCGAGGGCTGAACAGATGC
chr17 chr17 59431136 59431186 50M                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGGACCGGCCAAGGCTGGCGAGGGCTGAACAGATGCTCTGACATGTCA
chr17 chr17 59431143 59431193 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCCAAGGCTGGCGAGGGCTGAACAGATGCTCTGACATGTCAAGGGAGG
chr17 chr17 59431148 59431198 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGCTGGCGAGGGCTGAACAGATGCTCTGACATGTCAAGGGAGGAAATG
chr17 chr17 59431152 59431202 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGCGAGGGCTGAACAGATGCTCTGACATGTCAAGGGAGGAAATGACAG
chr17 chr17 59431156 59431206 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGGGCTGAACAGATGCTCTGACATGTCAAGGGAGGAAATGACAGTTCC
chr17 chr17 59431159 59431209 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCTGAACAGATGCTCTGACATGTCAAGGGAGGAAATGACAGTTCCCAG
chr17 chr17 59431162 59431212 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAACAGATGCTCTGACATGTCAAGGGAGGAAATGACAGTTCCCAGGCA
chr17 chr17 59431177 59431227 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACATGTCAAGGGAGGAAATGACAGTTCCCAGGCAGCCCTCTGTTTCAGG
chr17 chr17 59431182 59431232 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAAGGGAGGAAATGACAGTTCCCAGGCAGCCCTCTGTTTCAGGTGTCG
chr17 chr17 59431187 59431237 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAGGAAATGACAGTTCCCAGGCAGCCCTCTGTTTCAGGTGTGGAACAG
chr17 chr17 59431193 59431243 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGACAGTTCCCAGGCAGCCCTCTGTTTCAGGTGTGGAACAGGCCCCG
chr17 chr17 59431197 59431247 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGTTCCCAGGCAGCCCTCTGTTTCAGGTGTGGAACAGGCTCCGA
chr17 chr17 59431210 59431260 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCCCTCTGTTTCAGGTGTGGAACAGGCTCCGA
chr17 chr17 59431215 59431265 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTGTTTCAGGTGTGGAACAGGCTCCGA
chr17 chr17 59431223 59431273 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTGTGGAACAGGCTCCGA
chr17 chr17 59431226 59431276 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGTGGAACAGGCTCCGA
chr17 chr17 59431234 59431284 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCTCCGA
chr17 chr17 59431245 59431295 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         

3 pairs


MCF7 chr20-chr17 49411707 59445685 ff

106 116 167 0 37 36
00000000000008999999999999999999999999999999999999 99999999999999999999999999999999999800000000000000
BCAS4 exon1(49411465-49411709) BCAS3 exon24(59445686-59445854)

blast search - human genome


>ref|NC_000020.10| Homo sapiens chromosome 20, GRCh37.p2 primary reference assembly
          Length = 63025520

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 49411659 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 49411708

>ref|AC_000152.1| Homo sapiens chromosome 20, alternate assembly HuRef, whole genome shotgun
          Length = 59656706

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 46160015 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 46160064

>ref|AC_000063.1| Homo sapiens chromosome 20, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 59605541

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 46115926 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 46115975


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 59445686 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 59445735

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 54815325 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 54815374

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 58546731 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 58546780

blast search - nt


>ref|XM_001168029.1| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 1 (BCAS4), mRNA
          Length = 1697

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|XM_001168054.1| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 2 (BCAS4), mRNA
          Length = 1965

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 278

>ref|XM_514721.2| PREDICTED: Pan troglodytes breast carcinoma amplified sequence 4,
           transcript variant 3 (BCAS4), mRNA
          Length = 1832

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>gb|BC047337.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone IMAGE:5500336), partial cds
          Length = 1256

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 58  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 107

>gb|BC056883.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone IMAGE:5764497), partial cds
          Length = 1524

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 52  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 101

>gb|AF361220.1| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4) mRNA,
           complete cds
          Length = 968

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 278

>ref|NM_198799.2| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 2, mRNA
          Length = 1271

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|NM_017843.3| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 1, mRNA
          Length = 1368

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>ref|NM_001010974.1| Homo sapiens breast carcinoma amplified sequence 4 (BCAS4),
           transcript variant 3, mRNA
          Length = 1136

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 193 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 242

>emb|AL031680.20| Human DNA sequence from clone RP5-850H21 on chromosome 20q13.11-13.2
             Contains the the PARD6B gene for par-6 partitioning
             defective 6 homolog beta (C. elegans), the BCAS4 gene for
             breast carcinoma amplified sequence 4 and two CpG islands,
             complete sequence
          Length = 117431

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1     cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 77084 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 77133

>dbj|AK000502.1| Homo sapiens cDNA FLJ20495 fis, clone KAT08572
          Length = 831

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 92  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 141

>emb|AJ511266.1| Homo sapiens partial mRNA for breast carcinoma amplified sequence 4
           protein (BCAS4 gene), isoform 1
          Length = 365

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 53  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 102

>gb|BC038381.1| Homo sapiens breast carcinoma amplified sequence 4, mRNA (cDNA
           clone MGC:21149 IMAGE:4472674), complete cds
          Length = 1180

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
Sbjct: 79  cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 128

>gb|AF361221.1| Homo sapiens breast carcinoma amplified sequence 4/3 fusion protein
           (BCAS4/BCAS3 fusion) mRNA, complete cds
          Length = 1321

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           ||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 229 cagcggggcgcgcgagctcgcgctcttcctgacccccgatcctggggccg 278

>ref|XM_002722695.1| PREDICTED: Oryctolagus cuniculus breast carcinoma amplified
           sequence 4 (LOC100354578), mRNA
          Length = 594

 Score = 87.7 bits (44), Expect = 4e-15
 Identities = 47/48 (97%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggc 48
           |||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 129 cagcggggcgcgcgagctcgcgctcttcctgacccccgagcccggggc 176

>ref|XR_011531.2| PREDICTED: Macaca mulatta breast carcinoma-amplified sequence
           4-like (LOC706118), miscRNA
          Length = 624

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 141 cagcggagcgcgggagctcgcgctcttcctgacccccgagcctggggccg 190

>ref|XM_001095529.2| PREDICTED: Macaca mulatta breast carcinoma amplified sequence 4,
           transcript variant 2 (BCAS4), mRNA
          Length = 734

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 187 cagcggagcgcgggagctcgcgctcttcctgacccccgagcctggggccg 236

>ref|XM_002747669.1| PREDICTED: Callithrix jacchus breast carcinoma-amplified sequence
           4-like (LOC100388541), mRNA
          Length = 612

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggccg 50
           |||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 129 cagcggagcgcgcgagctcgccctcttcctgacccccgagcctggggccg 178

>ref|XM_849115.1| PREDICTED: Canis familiaris similar to breast carcinoma amplified
           sequence 4 isoform b (LOC611448), mRNA
          Length = 930

 Score = 79.8 bits (40), Expect = 1e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

Query: 1   cagcggggcgcgcgagctcgcgctcttcctgacccccgagcctggggc 48
           |||||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 261 cagcggggcgcgcgagctcgcgctcttcctgaccccggagcccggggc 308


>ref|NM_001099432.1| Homo sapiens breast carcinoma amplified sequence 3 (BCAS3),
            transcript variant 1, mRNA
          Length = 3626

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2578 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2627

>ref|NM_017679.3| Homo sapiens breast carcinoma amplified sequence 3 (BCAS3),
            transcript variant 2, mRNA
          Length = 3581

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2533 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2582

>dbj|AK225757.1| Homo sapiens mRNA for Splice isoform 3 of Q9H6U6 variant, clone:
          Length = 3703

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2492 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2541

>gb|BC117275.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA clone
            MGC:150884 IMAGE:40125826), complete cds
          Length = 2889

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2500 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2549

>gb|AF361221.1| Homo sapiens breast carcinoma amplified sequence 4/3 fusion protein
           (BCAS4/BCAS3 fusion) mRNA, complete cds
          Length = 1321

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 279 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 328

>gb|AF361219.1| Homo sapiens breast carcinoma amplified sequence 3 (BCAS3) mRNA,
            complete cds
          Length = 3514

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2472 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2521

>gb|BC001250.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA clone
            IMAGE:3458571), partial cds
          Length = 2060

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1020 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1069

>dbj|AK023054.1| Homo sapiens cDNA FLJ12992 fis, clone NT2RP3000149
          Length = 2903

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1880 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1929

>dbj|AK022526.1| Homo sapiens cDNA FLJ12464 fis, clone NT2RM1000780
          Length = 2779

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1782 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1831

>gb|AF260268.1|AF260268 Homo sapiens GAOB1 mRNA, complete cds
          Length = 1943

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 899 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 948

>emb|CR610433.1| full-length cDNA clone CS0DB009YB03 of Neuroblastoma Cot
          10-normalized of Homo sapiens (human)
          Length = 1011

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1  aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 7  aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 56

>dbj|AK025510.1| Homo sapiens cDNA: FLJ21857 fis, clone HEP02294
          Length = 3542

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 2494 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 2543

>dbj|AK000135.1| Homo sapiens cDNA FLJ20128 fis, clone COL06181
          Length = 2117

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1011 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1060

>emb|AL831895.1| Homo sapiens mRNA; cDNA DKFZp547L188 (from clone DKFZp547L188)
          Length = 2155

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1049 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1098

>gb|AC005746.1|AC005746 Homo sapiens chromosome 17, clone hRPK.332_H_18, complete sequence
          Length = 189356

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 46607 aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 46558

>gb|BC033220.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA
           clone IMAGE:5018525), with apparent retained intron
          Length = 2231

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

Query: 3   gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 936 gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 983

>gb|BC029983.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA clone
          Length = 2029

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

Query: 3    gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 969  gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1016

>gb|BC036280.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA clone
          Length = 2108

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

Query: 3    gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 1072 gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1119

>gb|BC013841.1| Homo sapiens breast carcinoma amplified sequence 3, mRNA (cDNA clone
          Length = 2031

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

Query: 3    gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
Sbjct: 969  gtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 1016

>ref|XM_002834129.1| PREDICTED: Pongo abelii hypothetical protein LOC100436919
           (LOC100436919), mRNA
          Length = 693

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Minus

Query: 1   aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
           ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 129 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 80

>ref|XM_002834103.1| PREDICTED: Pongo abelii DKFZP468H185 protein (DKFZP468H185), mRNA
          Length = 3306

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2204 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2253

>ref|XM_001110727.2| PREDICTED: Macaca mulatta breast carcinoma amplified sequence 3,
            transcript variant 5 (BCAS3), mRNA
          Length = 3468

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2440 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2489

>dbj|AK314744.1| Homo sapiens cDNA, FLJ95607, highly similar to Homo sapiens breast
            carcinoma amplified sequence 3 (BCAS3), mRNA
          Length = 2796

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2478 aggtacctttgacaggagcgtgaccctgctggaggtgagcgggagctggc 2527

>gb|BC149850.1| Bos taurus breast carcinoma amplified sequence 3, mRNA (cDNA clone
            IMAGE:8518099), partial cds
          Length = 3526

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2442 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2491

>dbj|AB171019.1| Macaca fascicularis brain cDNA clone: QorA-11870, similar to human
            breast carcinoma amplified sequence 3 (BCAS3), mRNA,
            RefSeq: NM_017679.2
          Length = 2354

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2097 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2146

>ref|XM_511611.2| PREDICTED: Pan troglodytes similar to breast carcinoma amplified
            sequence 3 (LOC454802), mRNA
          Length = 2959

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2578 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2627

>ref|XM_537707.2| PREDICTED: Canis familiaris similar to Breast carcinoma amplified
            sequence 3 (GAOB1) (Maab1 protein) (LOC480587), mRNA
          Length = 3063

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2745 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2794

>emb|CR859561.1| Pongo abelii mRNA; cDNA DKFZp468H185 (from clone DKFZp468H185)
          Length = 2736

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2485 aggtacctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2534

>ref|XM_002695612.1| PREDICTED: Bos taurus breast carcinoma amplified sequence 3 (BCAS3),
            partial mRNA
          Length = 2953

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||| ||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2286 aggtaccttcgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2335

>ref|XM_599680.5| PREDICTED: Bos taurus breast carcinoma amplified sequence 3 (BCAS3),
          Length = 3403

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||| ||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2736 aggtaccttcgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2785

>ref|XM_002719084.1| PREDICTED: Oryctolagus cuniculus breast carcinoma amplified sequence
            3 (LOC100358815), mRNA
          Length = 2742

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            ||||||||| ||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2424 aggtaccttcgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2473

>ref|XM_415889.2| PREDICTED: Gallus gallus breast carcinoma amplified sequence 3
            (BCAS3), mRNA
          Length = 3685

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

Query: 1    aggtacctttgacaggagcgtgaccctgctggaggtgtgcgggagctggc 50
            |||| |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2483 aggtgcctttgaccggagcgtgaccctgctggaggtgtgcgggagctggc 2532


chr20 chr20 49411498 49411548 50M                            CTGCCCCGCCTCCGCCAGGCGGTCCGCGGGGCATGCAGCGGACCGGGGGC
chr20 chr20 49411512 49411562 50M                                          CCAGGCGGTCCGCGGGGCATGCAGCCGACCGGGGGGGGGGCTCCGAGGCC
chr20 chr20 49411532 49411582 50M                                                              GCAGCGGACCGGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCC
chr20 chr20 49411535 49411585 50M                                                                 GCGGACCGGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAG
chr20 chr20 49411542 49411592 50M                                                                        GGGGGCGGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCT
chr20 chr20 49411548 49411598 50M                                                                              GGGGCTCCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCA
chr20 chr20 49411554 49411604 50M                                                                                    CCGAGGCCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGA
chr20 chr20 49411560 49411610 50M                                                                                          CCCGGGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGT
chr20 chr20 49411564 49411614 50M                                                                                              GGCGCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCC
chr20 chr20 49411567 49411617 50M                                                                                                 GCAACCACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTC
chr20 chr20 49411570 49411620 50M                                                                                                    ACCATGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTG
chr20 chr20 49411573 49411623 50M                                                                                                       ACGGGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATG
chr20 chr20 49411576 49411626 50M                                                                                                          GGCTCCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTG
chr20 chr20 49411580 49411630 50M                                                                                                              GCCAGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCG
chr20 chr20 49411583 49411633 50M                                                                                                                 AGGCAGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCATGG
chr20 chr20 49411587 49411637 50M                                                                                                                     AGCCTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGC
chr20 chr20 49411590 49411640 50M                                                                                                                        CTCCGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGA
chr20 chr20 49411593 49411643 50M                                                                                                                           CGCCAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCA
chr20 chr20 49411596 49411646 50M                                                                                                                              CAGCCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCC
chr20 chr20 49411599 49411649 50M                                                                                                                                 CCGGACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGG
chr20 chr20 49411602 49411652 50M                                                                                                                                    GACCCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCC
chr20 chr20 49411605 49411655 50M                                                                                                                                       CCCGTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCGA
chr20 chr20 49411608 49411658 50M                                                                                                                                          GTCGCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCG
chr20 chr20 49411611 49411661 50M                                                                                                                                             GCCCTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAG
chr20 chr20 49411614 49411664 50M                                                                                                                                                CTCCTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGG
chr20 chr20 49411617 49411667 50M                                                                                                                                                   CTGATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGC
chr20 chr20 49411620 49411670 50M                                                                                                                                                      ATGCTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCG
chr20 chr20 49411623 49411673 50M                                                                                                                                                         CTGCTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGA
chr20 chr20 49411626 49411676 50M                                                                                                                                                            CTCGTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCT
chr20 chr20 49411629 49411679 50M                                                                                                                                                               GTGGACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGC
chr20 chr20 49411632 49411682 50M                                                                                                                                                                  GACGCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCT
chr20 chr20 49411635 49411685 50M                                                                                                                                                                     GCTGATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTT
chr20 chr20 49411638 49411688 50M                                                                                                                                                                        GATCAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCT
chr20 chr20 49411641 49411691 50M                                                                                                                                                                           CAGCCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGAC
chr20 chr20 49411644 49411694 50M                                                                                                                                                                              CCGGAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCC
chr20 chr20 49411647 49411697 50M                                                                                                                                                                                 GAGCCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGG
chr20 chr20 49411650 49411700 50M                                                                                                                                                                                    CCCATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCC
chr20 chr20 49411653 49411703 50M                                                                                                                                                                                       ATGCGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGG
chr20 chr20 49411656 49411706 50M                                                                                                                                                                                          CGCAGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGC
chr20 chr20 49411659 49411709 50M                                                                                                                                                                                             AGCGGGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCGA
chr20 chr20 49411663 49411713 50M                                                                                                                                                                                                 GGGCGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCGAGGTA
chr20 chr17 49411666 59445693 42M59445686F8M                                                                                                                                                                                         CGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCT
chr20 chr17 49411666 59445693 42M59445686F8M                                                                                                                                                                                         CGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCT
chr20 chr17 49411666 59445693 42M59445686F8M                                                                                                                                                                                         CGCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCT
chr20 chr17 49411667 59445694 41M59445686F9M                                                                                                                                                                                          GCGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411668 59445695 40M59445686F10M                                                                                                                                                                                          CGCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTT
chr20 chr17 49411669 59445696 39M59445686F11M                                                                                                                                                                                           GCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTG
chr20 chr17 49411669 59445696 39M59445686F11M                                                                                                                                                                                           GCGAGCGCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTG
chr20 chr17 49411669 59445696 39M59445686F11M                                                                                                                                                                                           GCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTG
chr20 chr17 49411669 59445696 39M59445686F11M                                                                                                                                                                                           CCGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTG
chr20 chr17 49411670 59445697 38M59445686F12M                                                                                                                                                                                            CGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGA
chr20 chr17 49411670 59445697 38M59445686F12M                                                                                                                                                                                            CGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGA
chr20 chr17 49411670 59445697 38M59445686F12M                                                                                                                                                                                            CGAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGA
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411671 59445698 37M59445686F13M                                                                                                                                                                                             GAGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGAC
chr20 chr17 49411672 59445699 36M59445686F14M                                                                                                                                                                                              AGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACG
chr20 chr17 49411672 59445699 36M59445686F14M                                                                                                                                                                                              AGCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACG
chr20 chr17 49411673 59445700 35M59445686F15M                                                                                                                                                                                               GCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAG
chr20 chr17 49411673 59445700 35M59445686F15M                                                                                                                                                                                               GCTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAG
chr20 chr17 49411674 59445701 34M59445686F16M                                                                                                                                                                                                CTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGG
chr20 chr17 49411674 59445701 34M59445686F16M                                                                                                                                                                                                CTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGG
chr20 chr17 49411674 59445701 34M59445686F16M                                                                                                                                                                                                CTCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGG
chr20 chr17 49411675 59445702 33M59445686F17M                                                                                                                                                                                                 TCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGA
chr20 chr17 49411675 59445702 33M59445686F17M                                                                                                                                                                                                 TCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACGTTTGACAGGA
chr20 chr17 49411675 59445702 33M59445686F17M                                                                                                                                                                                                 TCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGA
chr20 chr17 49411675 59445702 33M59445686F17M                                                                                                                                                                                                 TCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGA
chr20 chr17 49411675 59445702 33M59445686F17M                                                                                                                                                                                                 TCGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGA
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACCGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGGCCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411676 59445703 32M59445686F18M                                                                                                                                                                                                  CGCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAG
chr20 chr17 49411677 59445704 31M59445686F19M                                                                                                                                                                                                   GCGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGC
chr20 chr17 49411678 59445705 30M59445686F20M                                                                                                                                                                                                    CGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCG
chr20 chr17 49411678 59445705 30M59445686F20M                                                                                                                                                                                                    CGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCG
chr20 chr17 49411678 59445705 30M59445686F20M                                                                                                                                                                                                    CGCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCG
chr20 chr17 49411679 59445706 29M59445686F21M                                                                                                                                                                                                     GCTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGT
chr20 chr17 49411680 59445707 28M59445686F22M                                                                                                                                                                                                      CTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTG
chr20 chr17 49411680 59445707 28M59445686F22M                                                                                                                                                                                                      CTCTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTG
chr20 chr17 49411680 59445707 28M59445686F22M                                                                                                                                                                                                      CTCTTCCCGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTG
chr20 chr17 49411682 59445709 26M59445686F24M                                                                                                                                                                                                        CTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGAC
chr20 chr17 49411682 59445709 26M59445686F24M                                                                                                                                                                                                        CTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGAC
chr20 chr17 49411682 59445709 26M59445686F24M                                                                                                                                                                                                        CTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGAC
chr20 chr17 49411682 59445709 26M59445686F24M                                                                                                                                                                                                        CTTCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGAC
chr20 chr17 49411684 59445711 24M59445686F26M                                                                                                                                                                                                          TCCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCC
chr20 chr17 49411685 59445712 23M59445686F27M                                                                                                                                                                                                           CCTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCT
chr20 chr17 49411686 59445713 22M59445686F28M                                                                                                                                                                                                            CTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCCG
chr20 chr17 49411686 59445713 22M59445686F28M                                                                                                                                                                                                            CTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTG
chr20 chr17 49411686 59445713 22M59445686F28M                                                                                                                                                                                                            CTGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTG
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411687 59445714 21M59445686F29M                                                                                                                                                                                                             TGACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGC
chr20 chr17 49411688 59445715 20M59445686F30M                                                                                                                                                                                                              GACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCA
chr20 chr17 49411688 59445715 20M59445686F30M                                                                                                                                                                                                              GACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCC
chr20 chr17 49411688 59445715 20M59445686F30M                                                                                                                                                                                                              GACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCT
chr20 chr17 49411688 59445715 20M59445686F30M                                                                                                                                                                                                              GACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCT
chr20 chr17 49411689 59445716 19M59445686F31M                                                                                                                                                                                                               ACCCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTG
chr20 chr17 49411691 59445718 17M59445686F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGA
chr20 chr17 49411691 59445718 17M59445686F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGA
chr20 chr17 49411691 59445718 17M59445686F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGA
chr20 chr17 49411691 59445718 17M59445686F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGA
chr20 chr17 49411691 59445718 17M59445686F33M                                                                                                                                                                                                                 CCCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGA
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAG
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAG
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGGCCCTGCTGGAG
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAG
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAG
chr20 chr17 49411692 59445719 16M59445686F34M                                                                                                                                                                                                                  CCCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411693 59445720 15M59445686F35M                                                                                                                                                                                                                   CCGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGG
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCAGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411694 59445721 14M59445686F36M                                                                                                                                                                                                                    CGATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGT
chr20 chr17 49411696 59445723 12M59445686F38M                                                                                                                                                                                                                      ATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGCGGTGT
chr20 chr17 49411696 59445723 12M59445686F38M                                                                                                                                                                                                                      ATCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGT
chr20 chr17 49411697 59445724 11M59445686F39M                                                                                                                                                                                                                       TCCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTG
chr20 chr17 49411697 59445724 11M59445686F39M                                                                                                                                                                                                                       ATCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTG
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        TCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411698 59445725 10M59445686F40M                                                                                                                                                                                                                        CCTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGC
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCN
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGAG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411699 59445726 9M59445686F41M                                                                                                                                                                                                                          CTGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCG
chr20 chr17 49411700 59445727 8M59445686F42M                                                                                                                                                                                                                           TGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGG
chr20 chr17 49411700 59445727 8M59445686F42M                                                                                                                                                                                                                           TGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGG
chr20 chr17 49411700 59445727 8M59445686F42M                                                                                                                                                                                                                           TGGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGG
chr20 chr17 49411701 59445728 7M59445686F43M                                                                                                                                                                                                                            GGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGG
chr20 chr17 49411701 59445728 7M59445686F43M                                                                                                                                                                                                                            GGGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGG
chr20 chr17 49411702 59445729 6M59445686F44M                                                                                                                                                                                                                             GGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGA
chr20 chr17 49411702 59445729 6M59445686F44M                                                                                                                                                                                                                             GGGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGA
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGAGTGTGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCCGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411703 59445730 5M59445686F45M                                                                                                                                                                                                                              GGCCG AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAG
chr20 chr17 49411704 59445731 4M59445686F46M                                                                                                                                                                                                                               GCCG AGGTACCTGTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGG
chr17 chr17 59445682 59445732 50M                                                                                                                                                                                                                                            CCGAGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCT
chr17 chr17 59445685 59445735 50M                                                                                                                                                                                                                                               AGGTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGC
chr17 chr17 59445689 59445739 50M                                                                                                                                                                                                                                                   ACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGA
chr17 chr17 59445692 59445742 50M                                                                                                                                                                                                                                                      GTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGG
chr17 chr17 59445695 59445745 50M                                                                                                                                                                                                                                                         GACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTT
chr17 chr17 59445698 59445748 50M                                                                                                                                                                                                                                                            AGGAGCGTGAACCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCGG
chr17 chr17 59445701 59445751 50M                                                                                                                                                                                                                                                               AGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCGGGCC
chr17 chr17 59445704 59445754 50M                                                                                                                                                                                                                                                                  GTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCG
chr17 chr17 59445707 59445757 50M                                                                                                                                                                                                                                                                     ACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCA
chr17 chr17 59445710 59445760 50M                                                                                                                                                                                                                                                                        CTGCTGGAGATGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACAT
chr17 chr17 59445713 59445763 50M                                                                                                                                                                                                                                                                           CTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTC
chr17 chr17 59445717 59445767 50M                                                                                                                                                                                                                                                                               AGGTGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTCCTCC
chr17 chr17 59445720 59445770 50M                                                                                                                                                                                                                                                                                  TGTGCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTCCTCCATG
chr17 chr17 59445723 59445773 50M                                                                                                                                                                                                                                                                                     GCGGGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTCCTCCATGGAG
chr17 chr17 59445726 59445776 50M                                                                                                                                                                                                                                                                                        GGAGCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTCCTCGATGGAGCAC
chr17 chr17 59445729 59445779 50M                                                                                                                                                                                                                                                                                           GCTGGCCTGAGGGCTTCGGGCTGCGGCACATGTCCTCCATGGAGCACACG
chr17 chr17 59445732 59445782 50M                                                                                                                                                                                                                                                                                              CGCCTCAGGGCTTCGGGCTGCGGCACATGTCCTCCATGGAGCACACGGAG
chr17 chr17 59445735 59445785 50M                                                                                                                                                                                                                                                                                                 CTGAGGGCTTCGGGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAG
chr17 chr17 59445738 59445788 50M                                                                                                                                                                                                                                                                                                    AGGGCTTCGGGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGC
chr17 chr17 59445741 59445791 50M                                                                                                                                                                                                                                                                                                       GCTTCGGGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTC
chr17 chr17 59445744 59445794 50M                                                                                                                                                                                                                                                                                                          TCGGGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGG
chr17 chr17 59445747 59445797 50M                                                                                                                                                                                                                                                                                                             GGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAG
chr17 chr17 59445750 59445800 50M                                                                                                                                                                                                                                                                                                                TGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGA
chr17 chr17 59445753 59445803 50M                                                                                                                                                                                                                                                                                                                   GGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTT
chr17 chr17 59445756 59445806 50M                                                                                                                                                                                                                                                                                                                      ACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCC
chr17 chr17 59445759 59445809 50M                                                                                                                                                                                                                                                                                                                         TGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGAC
chr17 chr17 59445762 59445812 50M                                                                                                                                                                                                                                                                                                                            CCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCC
chr17 chr17 59445765 59445815 50M                                                                                                                                                                                                                                                                                                                               CCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATG
chr17 chr17 59445768 59445818 50M                                                                                                                                                                                                                                                                                                                                  TGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCC
chr17 chr17 59445771 59445821 50M                                                                                                                                                                                                                                                                                                                                     AGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAG
chr17 chr17 59445774 59445824 50M                                                                                                                                                                                                                                                                                                                                        ACACGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAGTCA
chr17 chr17 59445777 59445827 50M                                                                                                                                                                                                                                                                                                                                           CGGAGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAGTCACCT
chr17 chr17 59445780 59445830 50M                                                                                                                                                                                                                                                                                                                                              AGGAGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAGTCACCTAGC
chr17 chr17 59445783 59445833 50M                                                                                                                                                                                                                                                                                                                                                 AGGGCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAGTCACCTAGCCGG
chr17 chr17 59445786 59445836 50M                                                                                                                                                                                                                                                                                                                                                    GCCTCCGGGAGCGACTTGCCGACGCCATGGCCGAGTCACCTAGCCGGGAC
chr17 chr17 59445789 59445839 50M                                                                                                                                                                                                                                                                                                                                                       GACGGGAGCGACTTGCCGACGCCATGGCCGAGTCACCTAGCCGGGACGTC
chr17 chr17 59445792 59445842 50M                                                                                                                                                                                                                                                                                                                                                          GGGAGCGACTTGCCGACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTG
chr17 chr17 59445795 59445845 50M                                                                                                                                                                                                                                                                                                                                                             AGCGACTTGCCGACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGA
chr17 chr17 59445798 59445848 50M                                                                                                                                                                                                                                                                                                                                                                GACTTGCCGACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCC
chr17 chr17 59445801 59445851 50M                                                                                                                                                                                                                                                                                                                                                                   TTGCCGACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGA
chr17 chr17 59445804 59445854 50M                                                                                                                                                                                                                                                                                                                                                                      CCGACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACA
chr17 chr17 59445807 59445857 50M                                                                                                                                                                                                                                                                                                                                                                         ACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACAGAC
chr17 chr17 59445810 59457871 45M12011N5M                                                                                                                                                                                                                                                                                                                                                                    CCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445813 59469345 42M23482N8M                                                                                                                                                                                                                                                                                                                                                                       TGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445816 59469348 39M23482N11M                                                                                                                                                                                                                                                                                                                                                                         CCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445819 59469351 36M23482N14M                                                                                                                                                                                                                                                                                                                                                                            AGTCACCTAGCCGGGACGTCGTGGGAACCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445822 59469354 33M23482N17M                                                                                                                                                                                                                                                                                                                                                                               CACCTAGCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445825 59469357 30M23482N20M                                                                                                                                                                                                                                                                                                                                                                                  CTAGCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 59445828 59469360 27M23482N23M                                                                                                                                                                                                                                                                                                                                                                                     GCCGGGACGTCGTGGGATCCGGAACAG||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

116 pairs


MCF7 chr17-chr17 57184949 57915653 ff

5 3 3 8 37 36
00000000000001111111122222222233344455555555555555 55555555555554444444433333333322211100000000000000
ENSG00000224738 exon1(57183957-57184951) TMEM49 exon11(57915654-57915757)

blast search - human genome


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 57184901 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 57184950

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 52545486 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 52545535

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 53647541 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 53647590


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 57915654 agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 57915703

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 53288143 agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 53288192

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 54379167 agtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 54379216

blast search - nt


>ref|XR_115135.1| PREDICTED: Homo sapiens hypothetical LOC100506847 (LOC100506847),
            partial miscRNA
          Length = 1332

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 1051 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 1100

>ref|XR_109417.1| PREDICTED: Homo sapiens hypothetical LOC100506847 (LOC100506847),
            partial miscRNA
          Length = 1332

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 1051 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 1100

>ref|XR_111729.1| PREDICTED: Homo sapiens hypothetical LOC100506847 (LOC100506847),
            partial miscRNA
          Length = 1333

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 1052 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 1101

>ref|NG_009298.1| Homo sapiens tripartite motif-containing 37 (TRIM37), RefSeqGene on
            chromosome 17
          Length = 131268

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 4366 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 4317

>gb|BC017255.2| Homo sapiens cDNA clone IMAGE:3352705, **** WARNING: chimeric clone
          Length = 2472

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 2060 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 2109

>gb|BC011742.2| Homo sapiens cDNA clone IMAGE:3350145, **** WARNING: chimeric clone
          Length = 2472

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 2060 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 2109

>gb|AC099850.7| Homo sapiens chromosome 17, clone CTD-2510F5, complete sequence
          Length = 210344

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1      atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
Sbjct: 156686 atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 156637

>gb|AC147317.3| Pan troglodytes BAC clone RP43-49P4 from chromosome 7, complete
          Length = 196949

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Minus

Query: 1     atctgctttctacagtttcctgccagatgtgtaaagattgcaagaattga 50
             |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 64874 atctgctttctacaatttcctgccagatgtgtaaagattgcaagaattga 64825


>ref|NM_001190897.1| Macaca mulatta transmembrane protein 49 (TMEM49), mRNA
          Length = 1437

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1022 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1070

>ref|XM_002748174.1| PREDICTED: Callithrix jacchus transmembrane protein 49-like,
            transcript variant 4 (LOC100407303), mRNA
          Length = 1512

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 982  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1030

>ref|XM_002748173.1| PREDICTED: Callithrix jacchus transmembrane protein 49-like,
           transcript variant 3 (LOC100407303), mRNA
          Length = 1422

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2   gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 892 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 940

>ref|XM_002748172.1| PREDICTED: Callithrix jacchus transmembrane protein 49-like,
           transcript variant 2 (LOC100407303), mRNA
          Length = 1356

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2   gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 826 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 874

>ref|XM_002748171.1| PREDICTED: Callithrix jacchus transmembrane protein 49-like,
            transcript variant 1 (LOC100407303), mRNA
          Length = 2017

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1089 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1137

>dbj|AB528826.1| Synthetic construct DNA, clone: pF1KE0432, Homo sapiens TMEM49 gene
            for transmembrane protein 49, without stop codon, in
            Flexi system
          Length = 1235

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 983  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1031

>dbj|AK294854.1| Homo sapiens cDNA FLJ50508 complete cds, highly similar to Homo
            sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 1332

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 993  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1041

>dbj|AK301254.1| Homo sapiens cDNA FLJ50706 complete cds, highly similar to Homo
            sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 1430

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 963  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1011

>dbj|AK293664.1| Homo sapiens cDNA FLJ50453 complete cds, highly similar to Homo
           sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 1358

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2   gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 859 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 907

>dbj|AK293578.1| Homo sapiens cDNA FLJ52586 complete cds, highly similar to Homo
           sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 1406

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2   gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 899 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 947

>ref|NM_030938.3| Homo sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 2197

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1247 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1295

>dbj|AB047551.1| Homo sapiens mRNA, novel lipopolysaccharide-inducible gene, complete
          Length = 1221

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 974  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1022

>gb|DQ892569.2| Synthetic construct clone IMAGE:100005199; FLH187623.01X;
            RZPDo839B05150D transmembrane protein 49 (TMEM49) gene,
            encodes complete protein
          Length = 1261

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 996  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1044

>dbj|AB171376.1| Macaca fascicularis brain cDNA clone: QorA-21631, similar to human
            likely ortholog of rat vacuole membrane protein 1(VMP1),
            mRNA, RefSeq: NM_030938.2
          Length = 2016

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1078 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1126

>dbj|AB170352.1| Macaca fascicularis brain cDNA clone: QmoA-10458, similar to human
            likely ortholog of rat vacuole membrane protein 1(VMP1),
            mRNA, RefSeq: NM_030938.2
          Length = 1277

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1060 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1108

>emb|AM393627.1| Synthetic construct Homo sapiens clone IMAGE:100001781 for
            hypothetical protein (TMEM49 gene)
          Length = 1260

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 994  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1042

>emb|AM393551.1| Synthetic construct Homo sapiens clone IMAGE:100001787 for
            hypothetical protein (TMEM49 gene)
          Length = 1260

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 994  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1042

>ref|XM_001137010.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 6 (TMEM49), mRNA
          Length = 6133

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 2069 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 2117

>ref|XM_001136208.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 1 (TMEM49), mRNA
          Length = 4661

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1958 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 2006

>ref|XM_001136866.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 4 (TMEM49), mRNA
          Length = 4691

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1988 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 2036

>ref|XM_511922.2| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 7 (TMEM49), mRNA
          Length = 4772

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 2069 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 2117

>ref|XM_001136792.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 3 (TMEM49), mRNA
          Length = 4098

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1395 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1443

>ref|XM_001136704.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 2 (TMEM49), mRNA
          Length = 3741

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1038 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1086

>ref|XM_001136943.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 5 (TMEM49), mRNA
          Length = 4811

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 2108 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 2156

>gb|AF214006.1|AF214006 Homo sapiens TDC1 (TDC1) mRNA, complete cds
          Length = 2530

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1087 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1135

>ref|NM_001132442.1| Pongo abelii transmembrane protein 49 (TMEM49), mRNA
 emb|CR859383.1| Pongo abelii mRNA; cDNA DKFZp459F2029 (from clone DKFZp459F2029)
          Length = 2630

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1109 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1157

>emb|CR623568.1| full-length cDNA clone CS0DA002YF12 of Neuroblastoma of Homo sapiens
          Length = 1978

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1069 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1117

>emb|CR608437.1| full-length cDNA clone CS0DN002YI16 of Adult brain of Homo sapiens
          Length = 1973

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1081 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1129

>emb|CR597083.1| full-length cDNA clone CS0DA003YA18 of Neuroblastoma of Homo sapiens
          Length = 1984

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1092 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1140

>emb|CR533521.1| Homo sapiens full open reading frame cDNA clone RZPDo834B1219D for
            gene VMP1, likely ortholog of rat vacuole membrane
            protein 1; complete cds, incl. stopcodon
          Length = 1301

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 974  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1022

>gb|BC009758.2| Homo sapiens transmembrane protein 49, mRNA (cDNA clone MGC:11204
            IMAGE:3927937), complete cds
          Length = 1800

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1098 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1146

>emb|AL136711.1| Homo sapiens mRNA; cDNA DKFZp566I133 (from clone DKFZp566I133)
          Length = 2052

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1107 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1155

>dbj|AK025987.1| Homo sapiens cDNA: FLJ22334 fis, clone HRC05837, highly similar to
            AF161410 Homo sapiens HSPC292 mRNA
          Length = 1929

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 986  gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1034

>dbj|AK024969.1| Homo sapiens cDNA: FLJ21316 fis, clone COL02253, highly similar to
            AF161410 Homo sapiens HSPC292 mRNA
          Length = 2047

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 1097 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 1145

>gb|AF161410.1|AF161410 Homo sapiens HSPC292 mRNA, partial cds
          Length = 1206

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

Query: 2   gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 50
Sbjct: 249 gtgctgtccccggcataggtccatctctgcagaagccatttcaggagta 297

>ref|XM_548240.2| PREDICTED: Canis familiaris similar to transmembrane protein 49
            (LOC491120), mRNA
          Length = 2515

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

Query: 2    gtgctgtccccggcataggtccatctctgcagaagccatttcagga 47
            |||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1574 gtgctgtccccggcataggtccatctctgcagaagccattccagga 1619


chr17 chr17 57184625 57184675 50M                            AGGTTCATGGTTAGTGGTTCTCTCTG
chr17 chr17 57184635 57184685 50M                            AGGTTCATGGTTAGTGGTTCTCTCTGGAAGGAACAG
chr17 chr17 57184639 57184689 50M                            AGGTTCATGGTTAGTGGTTCTCTCTGGAAGGAACAGTCTA
chr17 chr17 57184646 57184696 50M                            AGGTTCATGGTTAGTGGTTCTCTCTGGAAGGAACAGTCTAAGGTTTG
chr17 chr17 57184649 57184699 50M                            AGGTTCATGGTTAGTGGTTCTCTCTGGAAGGAACAGTCTAAGGTTTGTAG
chr17 chr17 57184655 57184705 50M                                  ATGGTTAGTGGTTCTCTCTGGAAGGAACAGTCTAAGGTTTGTAGGACTTG
chr17 chr17 57184662 57184712 50M                                         GTGGTTCTCTCTGGAAGGAACAGTCTAAGGTTTGTAGGACTTGCGTTCCA
chr17 chr17 57184679 57184729 50M                                                          GAACAGTCTAAGGTTTGTAGGACTTGCGTTCCACCTACCAAAGCTAATCG
chr17 chr17 57184684 57184734 50M                                                               GTCTAAGGTTTGTAGGACTTGCGTTCCACCTACCAAAGCTAATCGAGTTA
chr17 chr17 57184687 57184737 50M                                                                  TAAGGTTTGTAGGACTTGCGTTCCACCTACCAAAGCTAATCGAGTTAGAA
chr17 chr17 57184690 57184740 50M                                                                     GGTTTGTAGGACTTGCGTTCCACCTACCAAAGCTAATCGAGTTAGAAGGC
chr17 chr17 57184693 57184743 50M                                                                        TTGTAGGACTTGCGTTCCACCTACCAAAGCTAATCGAGTTAGAAGGCTCC
chr17 chr17 57184697 57184747 50M                                                                            AGGACTTGCGTTCCACCTACCAAAGCTAATCGAGTTAGAAGGCTCCAAAC
chr17 chr17 57184701 57184751 50M                                                                                CTTGCGTTCCACCTACCAAAGCTAATCGAGTTAGAAGGCTCCAAACTGAG
chr17 chr17 57184716 57184766 50M                                                                                               CCAAAGCTAATCGAGTTAGAAGGCTCCAAACTGAGGTGTCATTTCTCATT
chr17 chr17 57184719 57184769 50M                                                                                                  AAGCTAATCGAGTTAGAAGGCTCCAAACTGAGGTGTCATTTCTCATTACG
chr17 chr17 57184723 57184773 50M                                                                                                      TAATCGAGTTAGAAGGCTCCAAACTGAGGTGTCATTTCTCATTACGGTGG
chr17 chr17 57184732 57184782 50M                                                                                                               TAGAAGGCTCCAAACTGAGGTGTCATTTCTCATTACGGTGGTGAGAGGAC
chr17 chr17 57184737 57184787 50M                                                                                                                    GGCTCCAAACTGAGGTGTCATTTCTCATTACGGTGGTGAGAGGACGGGCT
chr17 chr17 57184740 57184790 50M                                                                                                                       TCCAAACTGAGGTGTCATTTCTCATTACGGTGGTGAGAGGACGGGACCAC
chr17 chr17 57184744 57184794 50M                                                                                                                           AACTGAGGTGTCATTTCTCATTACGGTGGTGAGAGGACGGGACCACACAC
chr17 chr17 57184753 57184803 50M                                                                                                                                    GTCATTTCTCATTACGGTGGTGGGAGGACGGGACCACACACTGTGAAGTC
chr17 chr17 57184756 57184806 50M                                                                                                                                       ATTTCTCATTACGGTGGTGAGAGGACGGGACCACACACTGTGAAGTCTTC
chr17 chr17 57184768 57184818 50M                                                                                                                                                   GGTGGTGAGAGGACGGGACCACACACTGTGAAGTCTTCGTTCCCACATCC
chr17 chr17 57184774 57184824 50M                                                                                                                                                         GAGAGGACGGGACCACACACTGTGAAGTCTTCGTTCCCACATCCCACACT
chr17 chr17 57184778 57184828 50M                                                                                                                                                             GGACGGGACCACACACTGTGAAGTCTTCGTTCCCACATCCCACACTTCAT
chr17 chr17 57184781 57184831 50M                                                                                                                                                                CGGGACCACACACTGTGAAGTCTTCGTTCCCACATCCCACACTTCATTCT
chr17 chr17 57184784 57184834 50M                                                                                                                                                                   GACCACACACTGTGAAGTCTTCGTTCCCACATCCCACACTTCATTCTTGC
chr17 chr17 57184787 57184837 50M                                                                                                                                                                      CACACACTGTGCAGTCTTCGTTCCCACATCCCACGCTTCATTCTTGCCGC
chr17 chr17 57184793 57184843 50M                                                                                                                                                                            CTGTGAAGTCTTCGTTCCCACATCCCACACTTCATTCTTGCCGCCTAAGT
chr17 chr17 57184798 57184848 50M                                                                                                                                                                                 AAGTCTTCGTTCCCACATCCCACACTTCATTCTTGCCGCCTAAGTTGTCG
chr17 chr17 57184801 57184851 50M                                                                                                                                                                                    TCTTCGTTCCCACATCCCACACTTCATTCTTGCCGCCTAAGTTGTCGCCG
chr17 chr17 57184805 57184855 50M                                                                                                                                                                                        CGTTCCCACATCCCACACTTCATTCTTGCCGCCTAAGTTGTCGCCGTGGG
chr17 chr17 57184811 57184861 50M                                                                                                                                                                                              CACATCCCACACTTCATTCTTGCCGCCTAAGTTGTCGCCGTGGGACTATT
chr17 chr17 57184815 57184865 50M                                                                                                                                                                                                  TCCCACACTTCATTCTTGCCGCCTAAGTTGTCGCCGTGGGACTATTGAAA
chr17 chr17 57184818 57184868 50M                                                                                                                                                                                                     CACACTTCATTCTTGCCGCCTAAGTTGTCGCCGTGGGACTATTGAAAGGG
chr17 chr17 57184825 57184875 50M                                                                                                                                                                                                            CATTCTTGCCGCCTAAGTTGTCGCCGTGGGACTATTGAAAGGGTATCAGC
chr17 chr17 57184837 57184887 50M                                                                                                                                                                                                                        CTAAGTTGTCGCCGTGGGACTATTGAAAGGGTATCAGCGATATTCATCTT
chr17 chr17 57184844 57184894 50M                                                                                                                                                                                                                               GTCGCCGTGGGACTATTGAAAGGGTATCAGCGATATTCATCTTTCCTATA
chr17 chr17 57184847 57184897 50M                                                                                                                                                                                                                                  GTCGTGGGACTATTGAAAGGGTATCAGCGATATTCATCTTTCCTATAAAT
chr17 chr17 57184850 57184900 50M                                                                                                                                                                                                                                     GTGGGACTATTGAAAGGGTATCAGCGATATTCATCTTTCCTATAAATGGG
chr17 chr17 57184853 57184903 50M                                                                                                                                                                                                                                        GGACTATTGAAAGGGTATCAGCGATATTCATCTTTCCTATAAATGGGATC
chr17 chr17 57184858 57184908 50M                                                                                                                                                                                                                                             ATTGAAAGGGTATCAGCGATATTCATCTTTCCTATAAATGGGATCTGCTT
chr17 chr17 57184861 57184911 50M                                                                                                                                                                                                                                                GAAAGGGTATCAGCGATATTCATCTTTCCTATAAATGGGATCTGCTTTCT
chr17 chr17 57184864 57184914 50M                                                                                                                                                                                                                                                   AGGGTATCAGCGATATTCATCTTTCCTATAAATGGGATCTGCTTTCTACA
chr17 chr17 57184871 57184921 50M                                                                                                                                                                                                                                                          CAGCGATATTCATCTTTCCTATAAATGGGATCTGCTTTCTACAGTTTCCT
chr17 chr17 57184881 57184931 50M                                                                                                                                                                                                                                                                    CATCTTTCCTATAAATGGGATCTGCTTTCTACAGTTTCCTGCCAGATGTG
chr17 chr17 57184892 57184942 50M                                                                                                                                                                                                                                                                               TAAATGGGATCTGCTTTCTACAGTTTCCTGCCAGATGTGTAAAGATTGCA
chr17 chr17 57184895 57184945 50M                                                                                                                                                                                                                                                                                  ATGGGATCTGCTTTCTACAGTTTCCTGCCAGATGTGTAAAGATTGCAAGA
chr17 chr17 57184904 57184954 50M                                                                                                                                                                                                                                                                                           GCTTTCTACAGTTTCCTGCCAGATGTGTAAAGATTGCAAGAATTGAAGGT
chr17 chr17 57184913 57915666 37M57915654F13M                                                                                                                                                                                                                                                                                        AGTTTCCTGCCAGATGTGTAAAGATTGCAAGAATTGA AGTGCTGTCCCCG
chr17 chr17 57184921 57915674 29M57915654F21M                                                                                                                                                                                                                                                                                                GCCAGATGTGTAAAGATTGCAAGAATTGA AGTGCTGTCCCCGGCATAGGT
chr17 chr17 57184930 57915683 20M57915654F30M                                                                                                                                                                                                                                                                                                         GTAAAGATTGCAAGAATTGA AGTGCTGTCCCCGGCATAGGTCCATCTCTG
chr17 chr17 57184933 57915686 17M57915654F33M                                                                                                                                                                                                                                                                                                            AAGATTGCAAGAATTGA AGTGCTGTCCCCGGCATAGGTCCATCTCTGCAG
chr17 chr17 57184936 57915689 14M57915654F36M                                                                                                                                                                                                                                                                                                               ATTGCAAGAATTGA AGTGCTGTCCCCGGCATAGGTCCATCTCTGCAGAAG
chr17 chr17 57915654 57915704 50M                                                                                                                                                                                                                                                                                                                                           GTGCTGTCCCCGGCATAGGTCCATCTCTGCAGAAGCCATTTCAGGAGTAC
chr17 chr17 57915659 57915709 50M                                                                                                                                                                                                                                                                                                                                                GTCCCCGGCATAGGTCCATCTCTGCAGAAGCCATTTCAGGAGTACCTGGA
chr17 chr17 57915662 57915712 50M                                                                                                                                                                                                                                                                                                                                                   CCCGCCATAGGTCCATCTCTGCAGAAGCCATTTCAGGAGTACCTGGAGGC
chr17 chr17 57915668 57915718 50M                                                                                                                                                                                                                                                                                                                                                         ATAGGTCCATCTCTGCAGAAGCCATTTCAGGAGTACCTGGAGGCTCAACG
chr17 chr17 57915671 57915721 50M                                                                                                                                                                                                                                                                                                                                                            GGTCCATCTCTGCAGAAGCCATTTCAGGAGTACCTGGAGGCTCAACGGCA
chr17 chr17 57915675 57915725 50M                                                                                                                                                                                                                                                                                                                                                                CATCTCTGCAGAAGCCATTTCAGGAGTACCTGGAGGCTCAACGGCATACG
chr17 chr17 57915678 57915728 50M                                                                                                                                                                                                                                                                                                                                                                   CTCTGCAGAAGCCATTTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTT
chr17 chr17 57915681 57915731 50M                                                                                                                                                                                                                                                                                                                                                                      TGCAGAAGCCATTTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCAC
chr17 chr17 57915684 57915734 50M                                                                                                                                                                                                                                                                                                                                                                         AGAAGCCATTTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCACCAC
chr17 chr17 57915687 57915737 50M                                                                                                                                                                                                                                                                                                                                                                            AGCCATTTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCACCACAAA
chr17 chr17 57915690 57915740 50M                                                                                                                                                                                                                                                                                                                                                                               CATTTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCACCACAAAAGC
chr17 chr17 57915693 57915743 50M                                                                                                                                                                                                                                                                                                                                                                                  TTCAGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCACCACAAAAGCGAA
chr17 chr17 57915696 57915746 50M                                                                                                                                                                                                                                                                                                                                                                                     AGGAGTACCTGGAGGCTCAACGGCAGAAGCTTCACCACAAAAGCGAAATG
chr17 chr17 57915699 57915749 50M                                                                                                                                                                                                                                                                                                                                                                                        AGTACCTGGAGGCTCAACGGCAGAAGCTTCACCACAAAAGTGAAATGGGC
chr17 chr17 57915702 57915752 50M                                                                                                                                                                                                                                                                                                                                                                                           ACCTGGCGTCTCAACGGCAGAAGCTTCACCACAAAAGCGAAATGGGCACA
chr17 chr17 57915705 57915755 50M                                                                                                                                                                                                                                                                                                                                                                                              TGGAGGCTCAACGGCAGAAGCTTCACCACAAAAGCGAAATGGGCACACCA
chr17 chr17 57915708 57915758 50M                                                                                                                                                                                                                                                                                                                                                                                                 AGGCTCAACGGCAGAAGCTTCACCACAAAAGCGAAATGGGCACACCACAG
chr17 chr17 57915711 57915761 50M                                                                                                                                                                                                                                                                                                                                                                                                    CTCAACGGCAGAAGCTTCACCACAAAAGCGAAATGGGCACACCACAGGGA
chr17 chr17 57915714 57915764 50M                                                                                                                                                                                                                                                                                                                                                                                                       AACGGCAGAAGCTTCACCACAAAAGCGAAATGGGCACACCACAGGTAAGA
chr17 chr17 57915718 57915768 50M                                                                                                                                                                                                                                                                                                                                                                                                           GCAGAAGCTTCACCACAAAAACGAAATGGGCACACCACAGGTAAGACTTT
chr17 chr17 57915721 57917141 37M1370N13M                                                                                                                                                                                                                                                                                                                                                                                                      GAAGCTTCACCACAAAAGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915724 57917144 34M1370N16M                                                                                                                                                                                                                                                                                                                                                                                                         GCTTCACCACAAAAGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915727 57917147 31M1370N19M                                                                                                                                                                                                                                                                                                                                                                                                            TCACCACAAAAGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915730 57917150 28M1370N22M                                                                                                                                                                                                                                                                                                                                                                                                               CCACAAAAGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915733 57917153 25M1370N25M                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAAGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915737 57917158 21M1370N24M1D5M                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGAAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915741 57917161 17M1370N33M                                                                                                                                                                                                                                                                                                                                                                                                                          AAATGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915744 57917164 14M1370N36M                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915747 57917167 11M1370N39M                                                                                                                                                                                                                                                                                                                                                                                                                                GCACACCACAG|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
chr17 chr17 57915752 57915802 50M                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACAGGTAAGACTTTAATCCGGTTTCTTCTCCCCTCTGGGAAGTTTCGG
chr17 chr17 57915770 57915820 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGGTTTCTTCTCCCCTCTGGGAAGTTTCGGGCTGAAATTACATTCACA
chr17 chr17 57915776 57915826 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTTCTCCCCTCTGGGAAGTTTCGGGCTGAAATTACATTCACAGCTCTC
chr17 chr17 57915781 57915831 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCCCTCTGGGAAGTTTCGGGCTGAAATTACATTCACAGCTCTCACTCA
chr17 chr17 57915790 57915840 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAAGTTTCGGGCTGAAATTACATTCACAGCTCTCACTCACATTTTTAG
chr17 chr17 57915842 57915892 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATAAGTGAAGTTGGTTTGCCAGTGTTCCTTGACAGAAGTTGAGCGTCT
chr17 chr17 57915859 57915909 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGCCAGTGTTCCTTGACAGAAGTTGAGCGTCTGTGTATGCTCTACTGGG
chr17 chr17 57915865 57915915 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTTCCTTGACAGAAGTTGAGCGTCTGTGTATGCTCTACTGGGAAATTT
chr17 chr17 57915876 57915926 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGTTGAGCGTCTGTGTATGCTCTACTGGGAAATTTGTCTTTGTCTT
chr17 chr17 57915899 57915949 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTACTGGGAAATTTGTCTTTGTCTTAGACTAGAAAGTGTAACTTCTGT
chr17 chr17 57915908 57915958 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATTTGTCTTTGTCTTAGACTAGAAAGTGTAACTTCTGTAC
chr17 chr17 57915929 57915979 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAGAAAGTGTAACTTCTGTAC
chr17 chr17 57915942 57915992 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCTGTAC

3 pairs


MCF7 chr17-chr17 57992061 57917126 ff

4 2 1 7 33 28
00000000000000000111113333334444444444444444444444 44444444444444444333331111110000000000000000000000
RPS6KB1 exon4(57991994-57992063) TMEM49 exon12(57917127-57917951)

blast search - human genome


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 57992013 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 57992062

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 53364442 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 53364491

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 54455522 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 54455571


>ref|NC_000017.10| Homo sapiens chromosome 17, GRCh37.p2 primary reference assembly
          Length = 81195210

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 57917127 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 57917176

>ref|AC_000149.1| Homo sapiens chromosome 17, alternate assembly HuRef, whole genome shotgun
          Length = 76567021

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 53289616 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 53289665

>ref|AC_000060.1| Homo sapiens chromosome 17, alternate assembly Hs_Celera, whole genome
                shotgun sequence
          Length = 77819263

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1        agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 54380640 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 54380689

blast search - nt


>ref|XM_002923313.1| PREDICTED: Ailuropoda melanoleuca ribosomal protein S6 kinase,
           70kDa, polypeptide 1 (RPS6KB1), mRNA
          Length = 1798

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 372 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 421

>ref|XM_002834114.1| PREDICTED: Pongo abelii ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 4 (RPS6KB1), mRNA
          Length = 5426

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 403 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 452

>ref|XM_002834113.1| PREDICTED: Pongo abelii ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 3 (RPS6KB1), mRNA
          Length = 4463

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>ref|XM_002834111.1| PREDICTED: Pongo abelii ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 1 (RPS6KB1), mRNA
          Length = 5492

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>ref|XM_001109701.2| PREDICTED: Macaca mulatta ribosomal protein S6 kinase, 70kDa,
           polypeptide 1 (RPS6KB1), mRNA
          Length = 2284

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>ref|XM_002748180.1| PREDICTED: Callithrix jacchus ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 3 (RPS6KB1), mRNA
          Length = 2595

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 405 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 454

>ref|XM_002748178.1| PREDICTED: Callithrix jacchus ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 1 (RPS6KB1), mRNA
          Length = 2659

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>dbj|AK297147.1| Homo sapiens cDNA FLJ53847 complete cds, highly similar to
           Ribosomal protein S6 kinase beta-1 (EC
          Length = 2046

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 405 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 454

>dbj|AK293247.1| Homo sapiens cDNA FLJ54786 complete cds, highly similar to
           Ribosomal protein S6 kinase beta-1 (EC
          Length = 1964

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 417 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 466

>emb|CU690966.1| Synthetic construct Homo sapiens gateway clone IMAGE:100021802 5'
           read RPS6KB1 mRNA
          Length = 1217

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 346 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 395

>dbj|AB384946.1| Synthetic construct DNA, clone: pF1KB4421, Homo sapiens RPS6KB1
           gene for ribosomal protein S6 kinase beta-1, complete
           cds, without stop codon, in Flexi system
          Length = 1592

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 339 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 388

>dbj|AK312875.1| Homo sapiens cDNA, FLJ93319, highly similar to Homo sapiens
           ribosomal protein S6 kinase, 70kDa, polypeptide
           1(RPS6KB1), mRNA
          Length = 1623

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 375 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 424

>ref|XM_001503753.1| PREDICTED: Equus caballus ribosomal protein S6 kinase, 70kDa,
           polypeptide 1 (RPS6KB1), mRNA
          Length = 5317

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 433 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 482

>ref|XR_030192.1| PREDICTED: Monodelphis domestica similar to G3 serine/threonine
           kinase (LOC100011566), mRNA
          Length = 2111

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 351 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 400

>ref|XM_001362395.1| PREDICTED: Monodelphis domestica similar to G3 serine/threonine
           kinase (LOC100010269), mRNA
          Length = 2087

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 330 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 379

>ref|XR_030394.1| PREDICTED: Monodelphis domestica hypothetical protein LOC100023530
           (LOC100023530), mRNA
          Length = 2231

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 503 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 552

>dbj|AB170947.1| Macaca fascicularis brain cDNA clone: QorA-11344, similar to human
           ribosomal protein S6 kinase, 70kDa, polypeptide
           1(RPS6KB1), mRNA, RefSeq: NM_003161.1
          Length = 1837

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 392 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 441

>gb|AC004686.2| Homo sapiens chromosome 17, clone RP5-1073F15, complete sequence
          Length = 133477

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 40618 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 40569

>ref|XM_523815.2| PREDICTED: Pan troglodytes similar to p70 ribosomal S6 kinase
           alpha-I, transcript variant 3 (LOC468426), mRNA
          Length = 1526

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>ref|XM_001138941.1| PREDICTED: Pan troglodytes similar to p70 ribosomal S6 kinase
           alpha-I, transcript variant 1 (LOC468426), mRNA
          Length = 4463

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>ref|XM_001139182.1| PREDICTED: Pan troglodytes similar to p70 ribosomal S6 kinase
           alpha-I, transcript variant 2 (LOC468426), mRNA
          Length = 5501

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 469 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 518

>gb|AC183963.2| Pan troglodytes BAC clone CH251-562F21 from chromosome 17, complete
          Length = 213058

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1      agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 150615 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 150566

>gb|BC053365.1| Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1,
           mRNA (cDNA clone MGC:61512 IMAGE:6142009), complete cds
          Length = 1998

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 371 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 420

>ref|NM_003161.2| Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1
           (RPS6KB1), mRNA
          Length = 5332

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 433 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 482

>ref|XM_862272.1| PREDICTED: Canis familiaris similar to ribosomal protein S6 kinase,
           70kDa, polypeptide 1, transcript variant 5 (LOC480580),
          Length = 2631

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 462 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 511

>ref|XM_862260.1| PREDICTED: Canis familiaris similar to ribosomal protein S6 kinase,
           70kDa, polypeptide 1, transcript variant 4 (LOC480580),
          Length = 2781

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 462 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 511

>ref|XM_862249.1| PREDICTED: Canis familiaris similar to ribosomal protein S6 kinase,
           70kDa, polypeptide 1, transcript variant 3 (LOC480580),
          Length = 2294

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 462 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 511

>ref|XM_862237.1| PREDICTED: Canis familiaris similar to ribosomal protein S6 kinase,
           70kDa, polypeptide 1, transcript variant 2 (LOC480580),
          Length = 610

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 427 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 476

>ref|XM_537702.2| PREDICTED: Canis familiaris similar to ribosomal protein S6 kinase,
           70kDa, polypeptide 1, transcript variant 1 (LOC480580),
          Length = 5295

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 462 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 511

>gb|BC036033.1| Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1,
           mRNA (cDNA clone IMAGE:5271809), complete cds
          Length = 2832

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 429 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 478

>dbj|AB169554.1| Macaca fascicularis brain cDNA, clone: QflA-12580, similar to human
           ribosomal protein S6 kinase, 70kDa, polypeptide
           1(RPS6KB1), mRNA, RefSeq: NM_003161.1
          Length = 1832

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 392 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 441

>gb|AY335785.1| Synthetic construct Homo sapiens ribosomal protein S6 kinase,
           70kDa, polypeptide 1 (RPS6KB1) mRNA, partial cds
          Length = 1578

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 330 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 379

>gb|M60725.1|HUMP70S6KB Human p70 ribosomal S6 kinase alpha-II mRNA, complete cds
          Length = 1791

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 359 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 408

>gb|M60724.1|HUMP70S6KA Human p70 ribosomal S6 kinase alpha-I mRNA, complete cds
          Length = 2346

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
Sbjct: 357 agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 406

>ref|XM_003131672.1| PREDICTED: Sus scrofa ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 2 (RPS6KB1), mRNA
          Length = 4134

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 417 agtaacaggagcaaataccgggaaaatatttgccatgaaggtgcttaaaa 466

>ref|XM_003131671.1| PREDICTED: Sus scrofa ribosomal protein S6 kinase, 70kDa,
           polypeptide 1, transcript variant 1 (RPS6KB1), mRNA
          Length = 4116

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 399 agtaacaggagcaaataccgggaaaatatttgccatgaaggtgcttaaaa 448

>gb|GU144017.1| Capra hircus S6 kinase polypeptide 1 (S6K1) mRNA, complete cds
          Length = 2272

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 330 agtaacaggagcaaataccgggaaaatatttgccatgaaggtgcttaaaa 379

>ref|XM_001509800.1| PREDICTED: Ornithorhynchus anatinus similar to G3 serine/threonine
           kinase (LOC100078852), mRNA
          Length = 1449

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 201 agtaacaggagctaatactgggaaaatatttgccatgaaggtgcttaaaa 250

>ref|NM_205816.1| Bos taurus ribosomal protein S6 kinase, 70kDa, polypeptide 1
           (RPS6KB1), mRNA
 gb|AY396564.1| Bos taurus p70S6K mRNA, complete cds
          Length = 1585

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 330 agtaacaggagcaaataccgggaaaatatttgccatgaaggtgcttaaaa 379

>ref|NM_001101690.1| Oryctolagus cuniculus ribosomal protein S6 kinase, 70kDa,
           polypeptide 1 (RPS6KB1), mRNA
 emb|X54415.1| Rabbit mRNA for serine/threonine kinase homologous to ribosomal
           protein S6 kinase
          Length = 1778

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1   agtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaa 50
           ||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 357 agtaacaggagcaaatactgggaaaatatttgctatgaaggtgcttaaaa 406


>ref|NM_030938.3| Homo sapiens transmembrane protein 49 (TMEM49), mRNA
          Length = 2197

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1349 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1398

>dbj|AB047551.1| Homo sapiens mRNA, novel lipopolysaccharide-inducible gene, complete
          Length = 1221

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1076 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1125

>gb|DQ892569.2| Synthetic construct clone IMAGE:100005199; FLH187623.01X;
            RZPDo839B05150D transmembrane protein 49 (TMEM49) gene,
            encodes complete protein
          Length = 1261

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1098 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1147

>emb|AM393627.1| Synthetic construct Homo sapiens clone IMAGE:100001781 for
            hypothetical protein (TMEM49 gene)
          Length = 1260

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1096 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1145

>emb|AM393551.1| Synthetic construct Homo sapiens clone IMAGE:100001787 for
            hypothetical protein (TMEM49 gene)
          Length = 1260

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1096 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1145

>gb|AC004686.2| Homo sapiens chromosome 17, clone RP5-1073F15, complete sequence
          Length = 133477

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1      agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 115504 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 115455

>gb|AY699265.1| Homo sapiens microRNA pri-miR-21, complete sequence
          Length = 3463

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 945 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 994

>gb|AF214006.1|AF214006 Homo sapiens TDC1 (TDC1) mRNA, complete cds
          Length = 2530

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1189 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1238

>ref|NM_001132442.1| Pongo abelii transmembrane protein 49 (TMEM49), mRNA
 emb|CR859383.1| Pongo abelii mRNA; cDNA DKFZp459F2029 (from clone DKFZp459F2029)
          Length = 2630

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1211 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1260

>emb|CR623568.1| full-length cDNA clone CS0DA002YF12 of Neuroblastoma of Homo sapiens
          Length = 1978

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1171 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1220

>emb|CR608437.1| full-length cDNA clone CS0DN002YI16 of Adult brain of Homo sapiens
          Length = 1973

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1183 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1232

>emb|CR597083.1| full-length cDNA clone CS0DA003YA18 of Neuroblastoma of Homo sapiens
          Length = 1984

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1194 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1243

>emb|CR533521.1| Homo sapiens full open reading frame cDNA clone RZPDo834B1219D for
            gene VMP1, likely ortholog of rat vacuole membrane
            protein 1; complete cds, incl. stopcodon
          Length = 1301

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1076 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1125

>gb|BC009758.2| Homo sapiens transmembrane protein 49, mRNA (cDNA clone MGC:11204
            IMAGE:3927937), complete cds
          Length = 1800

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1200 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1249

>gb|BC053563.1| Homo sapiens microRNA 21, mRNA (cDNA clone IMAGE:6190064)
          Length = 3404

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 901 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 950

>emb|AL136711.1| Homo sapiens mRNA; cDNA DKFZp566I133 (from clone DKFZp566I133)
          Length = 2052

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1209 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1258

>dbj|AK025987.1| Homo sapiens cDNA: FLJ22334 fis, clone HRC05837, highly similar to
            AF161410 Homo sapiens HSPC292 mRNA
          Length = 1929

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1088 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1137

>dbj|AK024969.1| Homo sapiens cDNA: FLJ21316 fis, clone COL02253, highly similar to
            AF161410 Homo sapiens HSPC292 mRNA
          Length = 2047

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 1199 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 1248

>gb|AF161410.1|AF161410 Homo sapiens HSPC292 mRNA, partial cds
          Length = 1206

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1   agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
Sbjct: 351 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 400

>ref|NM_001190897.1| Macaca mulatta transmembrane protein 49 (TMEM49), mRNA
          Length = 1437

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 46/46 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
Sbjct: 1124 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 1169

>dbj|AB171376.1| Macaca fascicularis brain cDNA clone: QorA-21631, similar to human
            likely ortholog of rat vacuole membrane protein 1(VMP1),
            mRNA, RefSeq: NM_030938.2
          Length = 2016

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 46/46 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
Sbjct: 1180 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 1225

>dbj|AB170352.1| Macaca fascicularis brain cDNA clone: QmoA-10458, similar to human
            likely ortholog of rat vacuole membrane protein 1(VMP1),
            mRNA, RefSeq: NM_030938.2
          Length = 1277

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 46/46 (100%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
Sbjct: 1162 agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 1207

>ref|XM_001137010.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 6 (TMEM49), mRNA
          Length = 6133

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 3532 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 3581

>ref|XM_001136208.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 1 (TMEM49), mRNA
          Length = 4661

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2060 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 2109

>ref|XM_001136866.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 4 (TMEM49), mRNA
          Length = 4691

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2090 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 2139

>ref|XM_511922.2| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 7 (TMEM49), mRNA
          Length = 4772

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2171 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 2220

>ref|XM_001136792.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 3 (TMEM49), mRNA
          Length = 4098

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1497 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 1546

>ref|XM_001136704.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 2 (TMEM49), mRNA
          Length = 3741

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1140 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 1189

>ref|XM_001136943.1| PREDICTED: Pan troglodytes transmembrane protein 49, transcript
            variant 5 (TMEM49), mRNA
          Length = 4811

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2210 agggagaaaactggttgtcctggatgtttgaaaagttggttgttgtcatg 2259

>ref|XM_002923315.1| PREDICTED: Ailuropoda melanoleuca transmembrane protein 49-like
            (LOC100463839), mRNA
          Length = 1670

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
            ||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1176 agggagaaaactggttgtcctggatgtttgagaagttggtcgttgt 1221

>ref|XM_002719255.1| PREDICTED: Oryctolagus cuniculus transmembrane protein 49
            (LOC100351532), mRNA
          Length = 1454

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
            ||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1076 agggagaaaactggttgtcctggatgtttgagaagttggtcgttgt 1121

>ref|XM_548240.2| PREDICTED: Canis familiaris similar to transmembrane protein 49
            (LOC491120), mRNA
          Length = 2515

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 45/46 (97%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
            ||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1676 agggagaaaactggttgtcctggatgtttgagaagttggtcgttgt 1721

>ref|XM_001362566.1| PREDICTED: Monodelphis domestica hypothetical protein LOC100010353
            (LOC100010353), mRNA
          Length = 1278

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatg 50
            |||| |||||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 1076 agggggaaaactggttgtcctggatgtttgaaaagttagtcattgtcatg 1125

>ref|NM_001075368.1| Bos taurus transmembrane protein 49 (TMEM49), mRNA
 gb|BC120116.1| Bos taurus transmembrane protein 49, mRNA (cDNA clone MGC:140672
            IMAGE:8273068), complete cds
          Length = 2067

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

Query: 1    agggagaaaactggttgtcctggatgtttgaaaagttggtcgttgt 46
            ||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 1181 agggagaaaactggttgtcctggatgtttgagaagttggttgttgt 1226


chr17 chr17 57990121 57992001 44M1830N6M                     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTT
chr17 chr17 57990125 57992005 40M1830N10M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAG
chr17 chr17 57990128 57992008 37M1830N13M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTAC
chr17 chr17 57990135 57992015 30M1830N20M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGT
chr17 chr17 57990139 57992019 26M1830N24M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACA
chr17 chr17 57990142 57992022 23M1830N27M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGA
chr17 chr17 57990145 57992025 20M1830N30M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGAGCA
chr17 chr17 57990148 57992028 17M1830N33M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGAGCAAAT
chr17 chr17 57990151 57992031 14M1830N36M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACT
chr17 chr17 57990154 57992034 11M1830N39M                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGG
chr17 chr17 57990159 57992039 6M1830N44M                     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAAT
chr17 chr17 57991783 57991833 50M                                                  TAGATGGTCATTGTCCAACATTACCACCAGATGGCAGCAGAACAAACAGG
chr17 chr17 57991892 57991942 50M                                                                                                                                                               TATAATATAAACTGCTGTGGCATATGTTTCTTATAACTAGGAATTAAGGG
chr17 chr17 57991991 57992041 50M                                                                                                                                                                                                                                                                  AAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATAT
chr17 chr17 57991994 57992044 50M                                                                                                                                                                                                                                                                     GGTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTTG
chr17 chr17 57991997 57992047 50M                                                                                                                                                                                                                                                                        TTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTTGCCA
chr17 chr17 57992002 57992052 50M                                                                                                                                                                                                                                                                             AAGTACGAAAAGTAACAGGAGCAAGTACTGGGAAAATATTTGCCATGAAG
chr17 chr17 57992005 57992055 50M                                                                                                                                                                                                                                                                                TACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTTGCCATGAAGGTG
chr17 chr17 57992008 57992058 50M                                                                                                                                                                                                                                                                                   GAAAAGTAACAGGAGCAAATACTGGGAAAATATTTGCCATGAAGGTGCTG
chr17 chr17 57992016 57992066 50M                                                                                                                                                                                                                                                                                           ACAGGAGCAAATACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGC
chr17 chr17 57992019 57992069 50M                                                                                                                                                                                                                                                                                              GGAGCAAATACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGCAAT
chr17 chr17 57992022 57917136 40M57917127F10M                                                                                                                                                                                                                                                                                     GCAAATACTGGGAAAATATTTGCCATGAAGGTGCTTAAAA AGGGAGAAAA
chr17 chr17 57992029 57917143 33M57917127F17M                                                                                                                                                                                                                                                                                            CTGGGAAAATATTTGCCATGAAGGTGCTTAAAA AGGGAGAAAACTGGTTG
chr17 chr17 57992034 57917148 28M57917127F22M                                                                                                                                                                                                                                                                                                 AAAATATTTGCCATGAAGGTGCTTAAAA AGGGAGAAAACTGGTTGTCCTG
chr17 chr17 57992034 57917148 28M57917127F22M                                                                                                                                                                                                                                                                                                 AAAATATTTGCCATGAAGGTGCTTAAAA AGGGAGAAAACTGGTTGTCCTG
chr17 chr17 57992040 57917154 22M57917127F28M                                                                                                                                                                                                                                                                                                       TTTGCCATGAAGGTGCTTAAAA AGGGAGAAAACTGGTTGTCCTGGATGTT
chr17 chr17 57992054 57917168 8M57917127F42M                                                                                                                                                                                                                                                                                                                      GCTTAAAA AGGGAGAAAACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCG
chr17 chr17 57917117 57917168 35M1D15M                                                                                                                                                                                                                                                                                                                            TATTTCTACAGGGAGAAAACTGGTTGTCCTGGATGDTTGAAAAGTTGGTCG
chr17 chr17 57917122 57917172 50M                                                                                                                                                                                                                                                                                                                                      CCACAGGGAGAAAACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGT
chr17 chr17 57917125 57917175 50M                                                                                                                                                                                                                                                                                                                                         CAGGGAGAAAACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCAT
chr17 chr17 57917128 57917178 50M                                                                                                                                                                                                                                                                                                                                            GGAGAAAACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGT
chr17 chr17 57917131 57917181 50M                                                                                                                                                                                                                                                                                                                                               GAAAACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTG
chr17 chr17 57917134 57917184 50M                                                                                                                                                                                                                                                                                                                                                  AACTGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTA
chr17 chr17 57917137 57917187 50M                                                                                                                                                                                                                                                                                                                                                     TGGTTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTACTT
chr17 chr17 57917140 57917190 50M                                                                                                                                                                                                                                                                                                                                                        TTGTCCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTACTTCAT
chr17 chr17 57917144 57917194 50M                                                                                                                                                                                                                                                                                                                                                            CCTGGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTACTTCATCCTA
chr17 chr17 57917147 57917197 50M                                                                                                                                                                                                                                                                                                                                                               GGATGTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTACTTCATCCTATCT
chr17 chr17 57917151 57917201 50M                                                                                                                                                                                                                                                                                                                                                                   GTTTGAAAAGTTGGTCGTTGTCATGGTGTGTTACTTCATCCTATCTATCA
chr17 chr17 57917154 57917204 50M                                                                                                                                                                                                                                                                                                                                                                      TGAAAAGTTGGTCGTTGTCATGGTGTGTTACTTCATCCTATCTATCATTA
chr17 chr17 57917158 57917208 50M                                                                                                                                                                                                                                                                                                                                                                          AAGTTGGTCGTTGTCATGGTGTGTTACTTCATCCTATCTATCATTAACTC
chr17 chr17 57917161 57917211 50M                                                                                                                                                                                                                                                                                                                                                                             TTGGTCGTTGTCATGGTGTGTTACTTCATCCTATCTATCATTAACTCCAT
chr17 chr17 57917164 57917214 50M                                                                                                                                                                                                                                                                                                                                                                                GTCGTTGTCATGGTGTGTTACTTCATCCTATCTATCATTAACTCCATGGC
chr17 chr17 57917168 57917218 50M                                                                                                                                                                                                                                                                                                                                                                                    TTGTCATGGTGTGTTACTTCATCCTATCTATCATTAACTCCATGGCACAA
chr17 chr17 57917173 57917223 50M                                                                                                                                                                                                                                                                                                                                                                                         ATGGTGTGTTACTTCATCCTATCTATCATTAACTCCATGGCACAAAGTTA
chr17 chr17 57917176 57917226 50M                                                                                                                                                                                                                                                                                                                                                                                            GTGTGTTACTTCATCCTATCTATCATTAACTCCATGGCACAAAGTTATGC
chr17 chr17 57917179 57917229 50M                                                                                                                                                                                                                                                                                                                                                                                               TGTTACTTCATCCTATCTATCATTAACTCCATGGCACAAAGTTATGCCAA
chr17 chr17 57917183 57917233 50M                                                                                                                                                                                                                                                                                                                                                                                                   ACTTCATCCTATCTATCATTAACTCCATGGCACAAAGTTATGCCAAACGA
chr17 chr17 57917187 57917237 50M                                                                                                                                                                                                                                                                                                                                                                                                       CATCCTATCTATCATTAACTCCATGGCACAAAGTTATGCCAAACGAATCC
chr17 chr17 57917190 57917240 50M                                                                                                                                                                                                                                                                                                                                                                                                          CCTATCTATCATTAACTCCATGGCACAAAGTTATGCCAAACGAATCCAGC
chr17 chr17 57917194 57917244 50M                                                                                                                                                                                                                                                                                                                                                                                                              TCTATCATTAACTCCATGGCACAAAGTTATGCCAAACGAATCCAGCAGCG
chr17 chr17 57917197 57917247 50M                                                                                                                                                                                                                                                                                                                                                                                                                 ATCATTAACTCCATGGCACAAAGTTATGCCAAACGAATCCAGCAGCGGTT
chr17 chr17 57917200 57917250 50M                                                                                                                                                                                                                                                                                                                                                                                                                    ATTAACTCCATGGCACAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAA
chr17 chr17 57917203 57917253 50M                                                                                                                                                                                                                                                                                                                                                                                                                       AACTCCATGGCACAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAACTC
chr17 chr17 57917206 57917256 50M                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATGGCACAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAACTCAGA
chr17 chr17 57917209 57917259 50M                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCACAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAACTCAGAGGA
chr17 chr17 57917212 57917262 50M                                                                                                                                                                                                                                                                                                                                                                                                                                GCACAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAACTCAGAGGAGAG
chr17 chr17 57917215 57917265 50M                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGTTATGCCAAACGAATCCAGCAGCGGTTGAACTCAGAGGAGAAAAC
chr17 chr17 57917218 57917268 50M                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTATGCCAAACGAATCCAGCAGCGGTTGAACTCAGAGGAGAAAACTAA
chr17 chr17 57917223 57917273 50M                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCCAAACGAATCCAGCAGCGGTTGAACTCAGAGGAGAAAACTAAATAAG
chr17 chr17 57917227 57917277 50M                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACGAATCCAGCAGCGGTTGAACTCAGAGGAGAAAACTAAATAAGTAGA
chr17 chr17 57917230 57917280 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAATCCAGCAGCGGTTGAACTCAGAGGAGAAAACTAAATAAGTAGAGAA
chr17 chr17 57917236 57917286 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAGCGGTTGAACTCAGAGGAGAAAACTAAATAAGTAGAGAAAGTTTT
chr17 chr17 57917239 57917289 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCGGTTGAACTCAGAGGAGAAAACTAAATAAGTAGAGAAAGTTTTAAA
chr17 chr17 57917243 57917293 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTGAACTCAGAGGAGAAAACTAAATAAGTAGAGAAAGTTTTAAACTGC
chr17 chr17 57917251 57917301 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGAGGAGAAAACTAAATAAGTAGAGAAAGTTTTAAACTGCAGAGATCG
chr17 chr17 57917254 57917304 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGAGAAAACTAAATAAGTAGAGAAAGTTTTAAACTGCAGAAATTGGAG
chr17 chr17 57917257 57917307 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAAAACTAAATAAGTAGAGAAAGTTTTAAACTGCAGAAATTGGAGTGG
chr17 chr17 57917261 57917311 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACTAAATAAGTAGAGAAAGTTTTAAACTGCAGAAATTGGAGTGGATGG
chr17 chr17 57917264 57917314 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAATAAGTAGAGAAAGTTTTAAACTGCAGAAATTGGAGTGGATGGGGG
chr17 chr17 57917269 57917319 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGTAGAGAAAGTTTTAAACTGCAGAAATTGGAGTGGATGGGTTCTGCC
chr17 chr17 57917277 57917327 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAGTTTTAAACTGCAGAAATTGGAGTGGATGGGTTCTGCCTTAAATTG
chr17 chr17 57917280 57917330 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTTTAAACTGCAGAAATTGGAGTGGATGGGTTCTGCCTTAAATTGGGA
chr17 chr17 57917284 57917334 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAACTGCAGAAATTGGAGTGGATGGGTTCTGCCTTAAATTGGGAGGAC
chr17 chr17 57917291 57917341 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGAAATTGGAGTGGATGGGTTCTGCCTTAAATTGGGAGGACTCCAAGC
chr17 chr17 57917294 57917344 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAATTGGAGTGGATGGGTTCTGCCTTAAATTGGGAGGACTCCAAGCTGG
chr17 chr17 57917297 57917347 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGGAGTGGATGGGTTCTGCCTTACATTGGGAGGACTCCACGCCGGGAA

2 pairs


MCF7 chr2-chr5 70329650 1799907 rf

5 14 1 0 35 23
00000000000000011223334555555555555555555555555555 55555555555555544332221000000000000000000000000000
ENSG00000226505 intron3(70322191-70329920) MRPL36 exon2(1799904-1799955)

blast search - human genome


>ref|NC_000002.11| Homo sapiens chromosome 2, GRCh37.p2 primary reference assembly
          Length = 243199373

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
Sbjct: 70329700 tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 70329651

>ref|AC_000134.1| Homo sapiens chromosome 2, alternate assembly HuRef, whole genome shotgun
          Length = 234808360

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
Sbjct: 70066074 tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 70066025

>ref|AC_000045.1| Homo sapiens chromosome 2, alternate assembly Hs_Celera, whole genome shotgun
          Length = 236827137

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1        tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
Sbjct: 70180473 tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 70180424


>ref|NC_000005.9| Homo sapiens chromosome 5, GRCh37.p2 primary reference assembly
          Length = 180915260

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1       ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
Sbjct: 1799908 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 1799957

>ref|AC_000137.1| Homo sapiens chromosome 5, alternate assembly HuRef, whole genome shotgun
          Length = 175444460

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1       ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
Sbjct: 1781543 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 1781592

>ref|AC_000048.1| Homo sapiens chromosome 5, alternate assembly Hs_Celera, whole genome
               shotgun sequence
          Length = 176344326

 Score = 99.6 bits (50), Expect = 3e-19
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1       ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
Sbjct: 1836572 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 1836621

blast search - nt


>ref|NG_002831.2| Homo sapiens mitochondrial ribosomal protein L36 pseudogene 1
           (MRPL36P1) on chromosome 2
          Length = 798

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1   tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
Sbjct: 180 tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 131

>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence
          Length = 177995

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Minus

Query: 1     tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
Sbjct: 18915 tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 18866

>ref|XM_517616.2| PREDICTED: Pan troglodytes similar to putative BRCA1-interacting
           protein (LOC461704), mRNA
          Length = 640

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Minus

Query: 1   tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcaccc 50
           |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 111 tataaaaagatttgccatgttgtggtgaatccggccgcgcgctctcaccc 62

>ref|XM_002815396.1| PREDICTED: Pongo abelii 39S ribosomal protein L36,
           mitochondrial-like (LOC100437496), mRNA
          Length = 644

 Score = 89.7 bits (45), Expect = 1e-15
 Identities = 48/49 (97%)
 Strand = Plus / Minus

Query: 1   tataaaaagagttgccatgttgtggtgaatccggccgcgcgctctcacc 49
           |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 112 tataaaaagatttgccatgttgtggtgaatccggccgcgcgctctcacc 64


>ref|NG_013354.1| Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa
            (NADH-coenzyme Q reductase) (NDUFS6), RefSeqGene on
            chromosome 5
          Length = 21670

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1    ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
Sbjct: 3413 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 3462

>gb|AC026443.4| Homo sapiens chromosome 5 clone CTD-2296H22, complete sequence
          Length = 118562

 Score = 99.6 bits (50), Expect = 1e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

Query: 1     ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
Sbjct: 68655 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 68704

>ref|NM_032479.3| Homo sapiens mitochondrial ribosomal protein L36 (MRPL36),
          nuclear gene encoding mitochondrial protein, mRNA
          Length = 626

 Score = 97.6 bits (49), Expect = 4e-18
 Identities = 49/49 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcac 49
Sbjct: 49 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcac 1

>ref|XM_001175244.1| PREDICTED: Pan troglodytes similar to putative BRCA1-interacting
           protein (LOC750868), mRNA
          Length = 1383

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Minus

Query: 1   ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
           ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 418 ggccgcacgatctcacccggcgccgacccctgcgtctgcgcactggcacg 369

>dbj|AK312001.1| Homo sapiens cDNA, FLJ92275, Homo sapiens mitochondrial ribosomal
          protein L36 (MRPL36), nucleargene encoding
          mitochondrial protein, mRNA
          Length = 373

 Score = 87.7 bits (44), Expect = 4e-15
 Identities = 44/44 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgcgcact 44
Sbjct: 47 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcact 4

>gb|BC104652.1| Homo sapiens mitochondrial ribosomal protein L36, mRNA (cDNA
          clone MGC:104245 IMAGE:6738291), complete cds
          Length = 642

 Score = 87.7 bits (44), Expect = 4e-15
 Identities = 44/44 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgcgcact 44
Sbjct: 48 ggccgcacgctctcacccggcgccgacccctgcgtctgcgcact 5

>ref|XM_002815393.1| PREDICTED: Pongo abelii 39S ribosomal protein L36,
           mitochondrial-like, transcript variant 2 (LOC100436235),
          Length = 683

 Score = 83.8 bits (42), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Minus

Query: 1   ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
           |||||| ||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 100 ggccgcgcgctctcaccctgcgccgacccctgcgtctgcgcactggcacg 51

>gb|AF155653.1|AF155653 Human putative ribosomal protein L36 mRNA
          Length = 613

 Score = 77.8 bits (39), Expect = 4e-12
 Identities = 39/39 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgc 39
Sbjct: 39 ggccgcacgctctcacccggcgccgacccctgcgtctgc 1

>gb|BC020642.1| Homo sapiens mitochondrial ribosomal protein L36, mRNA (cDNA
          clone MGC:22294 IMAGE:4774879), complete cds
          Length = 453

 Score = 77.8 bits (39), Expect = 4e-12
 Identities = 39/39 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgc 39
Sbjct: 39 ggccgcacgctctcacccggcgccgacccctgcgtctgc 1

>ref|XM_002815396.1| PREDICTED: Pongo abelii 39S ribosomal protein L36,
          mitochondrial-like (LOC100437496), mRNA
          Length = 644

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 47/50 (94%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctgcgcactggcacg 50
          |||||| ||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 80 ggccgcgcgctctcaccttgcgccgacccctgcgtctgcgcactggcacg 31

>gb|EF036487.1| Homo sapiens mitochondrial ribosomal protein L36 mRNA, complete
          cds; nuclear gene for mitochondrial product
          Length = 454

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 38/38 (100%)
 Strand = Plus / Minus

Query: 1  ggccgcacgctctcacccggcgccgacccctgcgtctg 38
Sbjct: 45 ggccgcacgctctcacccggcgccgacccctgcgtctg 8


chr2 chr2 70329998 70329948 50m                              AC
chr2 chr2 70329994 70329944 50m                              ACGTAC
chr2 chr2 70329991 70329941 50m                              ACGTACCAC
chr2 chr2 70329987 70329937 50m                              ACGTACCACTGAC
chr2 chr2 70329937 70329887 50m                                           CCCGCCTCTTCACCAGGTAACAGTCCTTGCAGCGCTTCTTAAGGACAGTC
chr2 chr2 70329934 70329884 50m                                              GCCTCTTCACCAGGTAACAGTCCTTGCAGCGCTTCTTAAGGACAGTCTTG
chr2 chr2 70329928 70329878 50m                                                    TCACCAGGTAACAGTCCTTGCAGCGCTTCTTAAGGACAGTCTTGTTTTTG
chr2 chr2 70329925 70329875 50m                                                       CCAGGTAACAGTCCTTGCAGCGCTTCTTAAGGACAGTCTTGTTTTTGAAC
chr2 chr2 70329922 70329872 50m                                                          GGTAACAGTCCTTGCAGCGCTTCTTAAGGACAGTCTTGTTTTTGAACCCC
chr2 chr2 70329906 70329856 50m                                                                          GCGCTTCTTAAGGACAGTCTTGTTTTTGAACCCCAGCGCAGGCAGCAGGT
chr2 chr2 70329843 70329793 50m                                                                                                                                         GGGTGAGAGAAGTGAGCGCACTGCTGCCCCGGGTTCCACAGCCACGGGGG
chr2 chr2 70329821 70329771 50m                                                                                                                                                               GCTGCCCCGGGTTCCACAGCCACGGGGGCTGCACCTCGAATGGATCCAAA
chr2 chr2 70329814 70329764 50m                                                                                                                                                                      CGGGTTCCACAGCCACGGGGGCTGCACCTCGAATGGATCCAAATAGAAAT
chr2 chr2 70329798 70329748 50m                                                                                                                                                                                      GGGGGCTGCACCTCGAATGGATCCAAATAGAAATGTGGAGAGGGCTCGAG
chr2 chr2 70329787 70329737 50m                                                                                                                                                                                                 CTCGAATGGATCCAAATAGAAATGTGGAGAGGGCTCGAGGCTTCACCGTG
chr2 chr2 70329779 70329729 50m                                                                                                                                                                                                         GATCCAAATAGAAATGTGGAGAGGGCTCGAGGCTTCACCGTGTGACGACT
chr2 chr2 70329714 70329664 50m                                                                                                                                                                                                                                                                          GTTCACCATTTTCCTTATAAAAAGATTTGCCATGTTGTGGTGAATCCGGC
chr2 chr2 70329709 70329659 50m                                                                                                                                                                                                                                                                               CCATTTTCCTTATAAAAAGATTTGCCATGTTGTGGTGAATCCGGCCGCAC
chr2 chr2 70329705 70329655 50m                                                                                                                                                                                                                                                                                   TTTCCTTATAAAAAGATTTGCCATGTTGTGGTGAATCCGGCCGCACGCTC
chr2 chr2 70329701 70329651 50m                                                                                                                                                                                                                                                                                       CTTATAAAAAGATTTGCCATGTTGTGGTGAATCCGGCCGCACGCTCTCAC
chr2 chr5 70329689 1799917 40m1799908F10M                                                                                                                                                                                                                                                                                         TTTGCCATGTTGTGGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGC
chr2 chr5 70329684 1799922 35m1799908F15M                                                                                                                                                                                                                                                                                              CATGTTGTGGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGCTCTCA
chr2 chr5 70329682 1799924 33m1799908F17M                                                                                                                                                                                                                                                                                                TGTTGTGGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGCTCTCCCC
chr2 chr5 70329680 1799926 31m1799908F19M                                                                                                                                                                                                                                                                                                  TTGTGGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGCTCTCACCCG
chr2 chr5 70329677 1799929 28m1799908F22M                                                                                                                                                                                                                                                                                                     TGGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGCTCTCACCCGGCG
chr2 chr5 70329676 1799930 27m1799908F23M                                                                                                                                                                                                                                                                                                      GGTGAATCCGGCCGCACGCTCTCACCC GGCCGCACGCTCTCACCCGGCGC
chr5 chr5 1799910 1799960 50M                                                                                                                                                                                                                                                                                                                                                 CGCACGCTCTCACCCGGCGCCGACCCCTGCGTCTGCGCACTGGCACGCGG
chr5 chr5 1799919 1799969 50M                                                                                                                                                                                                                                                                                                                                                          TCACCCGGCGCCGACCCCTGCGTCTGCGCACTGGCACGCGGACGCTGCTG
chr5 chr5 1799927 1799977 50M                                                                                                                                                                                                                                                                                                                                                                  CGCCGACCCCTGCGTCTGCGCACTGGCACGCGGACGCTGCTGCCAGGAAG
chr5 chr5 1800088 1800138 50M                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGCGCACTCTGCGGGCCACCGGGATCGTCGTGCTGTTGGGAGCGCTCTC

14 pairs


Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer

Author, Year Journal Reference Number Investigation Number Morphology Topography Short Karyotype Gene
Aamot et al 2005 Br J Haematol 11188 1 Acute megakaryoblastic leukemia (FAB type M7) t(9;22;14)(q34;q11;q32) BCR/ABL1
Aamot et al 2005 Br J Haematol 11188 2 Chronic lymphocytic leukemia t(14;22)(q32;q11) IGH@/IGL@
Aamot et al 2005 Br J Haematol 11188 3 Diffuse large B-cell lymphoma t(14;22)(q32;q11) IGH@/IGL@
Aamot et al 2005 Br J Haematol 11189 1 Nodal marginal zone B-cell lymphoma t(4;14)(p14;q32) IGH@/RHOH
Aamot et al 2005 Br J Haematol 11189 2 Splenic marginal zone B-cell lymphoma t(4;14)(p13;q32) IGH@+
Abdelhaleem et al 2007 Leukemia 12132 1 Acute megakaryoblastic leukemia (FAB type M7) t(10;11)(p12;q14) PICALM/MLLT10
Abdelhaleem et al 2007 J Pediatr Hematol Oncol 12207 1 Acute myelomonocytic leukemia (FAB type M4) inv(8)(p11q13) MYST3/NCOA2
Abdelmoula et al 2005 Cancer Genet Cytogenet 11269 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(4;11;22)(q25;q24;q12) EWSR1/FLI1
Abdou et al 2002 Leuk Lymphoma 10284 1 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(p12;q14) PICALM/MLLT10
Abe et al 1989 Cancer Genet Cytogenet 2848 1 Chronic myeloid leukemia, aberrant translocation t(9;15;22)(q34;q24;q11) BCR+
Abe et al 1989 Cancer Genet Cytogenet 2848 2 Chronic myeloid leukemia, aberrant translocation t(2;9;13;22)(q33;q34;q32;q11) BCR+
Abe et al 1989 Cancer Genet Cytogenet 2848 3 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(p23;q34;q11) BCR+
Abe et al 1989 Cancer Genet Cytogenet 2848 4 Chronic myeloid leukemia, aberrant translocation t(9;11;22)(q34;q23;q11) BCR+
Abe et al 1989 Cancer Genet Cytogenet 2848 5 Chronic myeloid leukemia, aberrant translocation t(8;9;22)(p21;q34;q11) BCR+
Abe et al 1997 Blood 7439 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(5;14)(q32;q32) TRIP11/PDGFRB
Abe et al 2008 Cancer Genet Cytogenet 12503 1 Acute promyelocytic leukemia (FAB type M3) t(5;17;15)(q11;q21;q22) PML/RARA
Abruzzese et al 1998 Cancer Genet Cytogenet 7608 1 Chronic myeloid leukemia, aberrant translocation ins(9;22)(q34;q11q11) BCR/ABL1
Abruzzese et al 2007 Cancer 11982 1 Chronic myeloid leukemia, aberrant translocation t(7;9;22;)(p22;q34;q11) BCR/ABL1
Acar et al 1997 Cancer Genet Cytogenet 6868 1 Chronic myeloid leukemia, aberrant translocation t(6;8;9;22)(q25;q22;q34;q11) BCR/ABL1
Acar et al 1997 Cancer Genet Cytogenet 6868 2 Chronic myeloid leukemia, aberrant translocation t(9;22;17)(q34;q11;p13) BCR/ABL1
Achuthan et al 2000 Genes Chromosomes Cancer 8757 1 Extranodal marginal zone B-cell lymphoma Stomach t(1;2)(p22;p11) IGK@/BCL10
Adachi & Tsujimoto 1989 Oncogene 3180 1 Chronic lymphocytic leukemia t(18;22)(q21;q11) IGL@/BCL2
Adachi et al 1989 Proc Natl Acad Sci U S A 2914 1 Chronic lymphocytic leukemia t(18;22)(q21;q11) IGL@/BCL2
Adam et al 2003 Am J Surg Pathol 10395 1 Diffuse large B-cell lymphoma t(2;5)(p23;q35) NPM1/ALK
Adelaide et al 2006 Leukemia 11406 1 Peripheral T-cell lymphoma, unspecified t(8;9)(p22;p24) PCM1/JAK2
Adelaide et al 2003 Genes Chromosomes Cancer 11149 1 Adenocarcinoma Breast t(8;10)(p12;p12) NRG1+
Adelaide et al 2003 Genes Chromosomes Cancer 11149 2 Adenocarcinoma Breast hsr(8)(p12) NRG1+
Adelaide et al 2003 Genes Chromosomes Cancer 11149 3 Adenocarcinoma Breast t(3;8)(?;p12) NRG1+
Adelaide et al 2003 Genes Chromosomes Cancer 11149 4 Adenocarcinoma Pancreas del(8)(p12) NRG1+
Adelaide et al 2003 Genes Chromosomes Cancer 11149 5 Adenocarcinoma Pancreas t(4;8)(?;p12) NRG1+
Aghib et al 1990 Oncogene 3569 1 Mycosis fungoides/Sezary syndrome t(2;8)(q23;q24) MYC+
Aguiar et al 1997 Blood 7243 1 Acute monoblastic leukemia (FAB type M5) inv(8)(p11q13) MYST3+
Ahmad et al 2008 Cancer Genet Cytogenet 12318 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(1;8;21)(p35;q22;q22) RUNX1/RUNX1T1
Ahmed et al 2006 Pediatr Dev Pathol 11760 1 Ewing tumor/peripheral primitive neuroectodermal tumor Oral cavity t(11;22)(q24;q12) EWSR1/FLI1
Ahmed et al 2006 Pediatr Dev Pathol 11760 2 Ewing tumor/peripheral primitive neuroectodermal tumor Adrenal t(11;22)(q24;q12) EWSR1/FLI1
Ahuja et al 1999 Blood 8334 1 Acute myeloid leukemia, NOS t(11;20)(p15;q12) NUP98/TOP1
Ahuja et al 1999 Blood 8334 2 Refractory anemia with excess of blasts (FAB) t(11;20)(p15;q12) NUP98/TOP1
Ahuja et al 2000 Cancer Res 8959 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;11)(p22;p15) NUP98/PSIP1
Ahuja et al 2001 Genes Chromosomes Cancer 8906 1 Chronic myeloid leukemia, t(9;22) t(7;11)(p15;p15) NUP98/HOXA9
Ahuja et al 2001 Genes Chromosomes Cancer 8906 2 Chronic myeloid leukemia, t(9;22) der(11)t(2;11)(q13;p15)t(11;11)(q13;p15) NUP98+
Akagi et al 1999 Oncogene 8426 1 Extranodal marginal zone B-cell lymphoma Lung t(11;18)(q21;q21) MALT1+
Akagi et al 1999 Oncogene 8426 2 Extranodal marginal zone B-cell lymphoma Large intestine t(11;18)(q21;q21) MALT1+
Akao & Isobe 2000 Genes Chromosomes Cancer 8442 1 Acute monoblastic leukemia (FAB type M5) t(6;11)(q27;q23) MLL/MLLT4
Akao et al 1990 Cancer Res 3588 1 Mature B-cell neoplasm, NOS t(11;14)(q23;q32) IGH@+
Akao et al 1991 Cancer Res 3805 1 Mature B-cell neoplasm, NOS t(11;14)(q23;q32) IGH@+
Akao et al 1992 Cancer Res 4633 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(q23;q32) IGH@/DDX6
Akasaka et al 1997 Cancer Res 6834 1 Mature B-cell neoplasm, NOS t(3;6)(q27;p22) HIST1H4I/BCL6
Akasaka et al 2003 Blood 10357 1 Follicular lymphoma t(3;16)(q27;p13) CIITA/BCL6
Akasaka et al 2003 Blood 10357 2 Follicular lymphoma t(3;3)(q25;q27) MBNL1/BCL6
Akasaka et al 2003 Blood 10357 3 Follicular lymphoma t(3;3)(q27;q27) EIF4A2/BCL6
Akasaka et al 2003 Blood 10357 4 Follicular lymphoma t(3;6)(q27;q14) SNHG5/BCL6
Akasaka et al 2003 Blood 10357 5 Follicular lymphoma t(3;9)(q27;p13) GRHPR/BCL6
Akasaka et al 2003 Blood 10357 6 Follicular lymphoma t(3;12)(q27;p12) LRMP/BCL6
Akasaka et al 2003 Blood 10357 7 Follicular lymphoma t(3;19)(q27;q13) NAPA/BCL6
Akasaka et al 2007 Blood 11901 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;19)(q32;q13) IGH@/CEBPA
Akasaka et al 2007 Blood 11901 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;19)(q32;q13) IGH@/CEBPG
Akasaka et al 2007 Blood 11901 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q11;q32) IGH@/CEBPD
Akasaka et al 2007 Blood 11901 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;14;8)(p11;q32;q11) IGH@/CEBPD
Akasaka et al 2007 Blood 11901 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;14)(q11;q32) IGH@/CEBPE
Akasaka et al 2007 Blood 11901 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(14)(q11q32) IGH@/CEBPE
Akasaka et al 2007 Blood 11901 7 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;20)(q32;q13) IGH@/CEBPB
Akashi et al 1993 Leuk Res 5038 1 Bilineage or biphenotypic leukemia t(9;22)(q34;q11) BCR/ABL1
Akiyama et al 1994 Cancer Res 5302 1 Mature B-cell neoplasm, NOS t(11;14)(q13;q32) IGH@/CCND1
Akiyama et al 1994 Cancer Res 5302 2 Multiple myeloma t(11;14)(q13;q32) IGH@/CCND1
Al-Achkar et al 2007 J Exp Clin Cancer Res 12234 1 Chronic myeloid leukemia, aberrant translocation t(5;9;22)(p15;q34;q11) BCR/ABL1
Alaggio et al 2007 Am J Surg Pathol 11870 1 Soft tissue tumor, special type Intraabdominal t(11;22)(p13;q12) EWSR1/WT1
Albano et al 2005 Leuk Res 11058 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;11;16;21)(q22;q14;q12;q22) RUNX1/RUNX1T1
Albano et al 2008 Ann Hematol 12626 1 Chronic myeloid leukemia, t(9;22) der(9)ins(9;9)(q?;q34)t(9;22)(q34;q11) BCR/ABL1
Alimena et al 1995 Leukemia 6116 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(2;9;22)(q37;q34;q11) BCR/ABL1
Alitalo et al 1985 Lancet 1391 1 Acute myeloblastic leukemia with maturation (FAB type M2) dmin +MYC
Allford et al 1999 Br J Haematol 8141 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(15;17)(q22;q21) PML/RARA
Allford et al 1999 Br J Haematol 8141 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(15;17)(q22;q21) PML/RARA
Almire et al 2007 Genes Chromosomes Cancer 12073 1 Peripheral T-cell lymphoma, unspecified t(14;19)(q11;q13) TRA@/PVRL2
Almire et al 2007 Genes Chromosomes Cancer 12073 2 Angioimmunoblastic T-cell lymphoma t(14;19)(q11;q13) TRA@/PVRL2
Alonso et al 2010 Leuk Res 13390 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(11)(q12q23) MLL/BTBD18
Alseraye et al 2009 Cancer Genet Cytogenet 12920 1 Follicular lymphoma dmin +MYC
Ambani et al 2006 Gynecol Oncol 11321 1 Synovial sarcoma Vagina t(X;18)(p11;q11) SS18/SSX2
Amiel et al 1994 Cancer Genet Cytogenet 5362 1 Chronic lymphocytic leukemia t(14;18)(q32;q21) IGH@/BCL2
An et al 2008 Proc Natl Acad Sci U S A 12660 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22;21)(q34;q11;q22) BCR/ABL1
An et al 2008 Proc Natl Acad Sci U S A 12660 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(7;9)(p12;p13) PAX5/LOC392027
An et al 2008 Proc Natl Acad Sci U S A 12660 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;12)(p13;p12) PAX5/SLCO1B3
An et al 2008 Proc Natl Acad Sci U S A 12660 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;20)(p13;q11) PAX5/ASXL1
An et al 2008 Proc Natl Acad Sci U S A 12660 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;20)(p13;q11) PAX5/KIF3B
An et al 2008 Proc Natl Acad Sci U S A 12660 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;20)(p13;q11) PAX5/C20ORF112
An et al 2009 Haematologica 13278 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;20)(p13;q11) ZCCHC7+
Anastasi et al 1996 Leukemia 6590 1 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p34;q34;q11) BCR/ABL1
Andersen et al 2001 Genes Chromosomes Cancer 8899 1 Myelodysplastic syndrome, NOS der(11)(q23) +MLL
Andersen et al 2001 Genes Chromosomes Cancer 8899 2 Acute myeloid leukemia, NOS add(11)(q23) +MLL
Anderson et al 1989 Cancer Genet Cytogenet 3112 1 Chronic myeloid leukemia, aberrant translocation t(9;10;22)(q34;q22;q11) BCR+
Anderson et al 1989 Cancer Genet Cytogenet 3112 2 Chronic myeloid leukemia, aberrant translocation t(12;22)(q13;q11) BCR+
Anderson et al 1989 Cancer Genet Cytogenet 3112 3 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q21;q34;q11) BCR+
Andersson et al 2001 Leukemia 9264 1 Acute myeloid leukemia, NOS t(10;11)(p12;q23) MLL/MLLT10
Andersson et al 2001 Leukemia 9264 2 Acute myeloid leukemia, NOS t(6;11)(q27;q23) MLL/MLLT4
Andreasson et al 1997 Genes Chromosomes Cancer 7186 1 Atypical chronic myeloid leukemia ins(9;12)(q34;p13p13) ETV6/ABL1
Andreasson et al 1998 Leukemia 7160 1 Acute undifferentiated leukemia t(4;12)(q12;p13) ETV6+
Andreasson et al 1998 Leukemia 7160 2 Acute myeloid leukemia, NOS ins(11;12)(q2?;p13p13) ETV6+
Andreasson et al 1998 Leukemia 7160 3 Acute myeloid leukemia, NOS ins(9;12)(?;p13p13) ETV6+
Andreasson et al 2000 Eur J Haematol 8578 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(11;14)(q23;q?) MLL+
Andrews & Collins 1987 Leukemia 2164 1 Chronic myeloid leukemia, aberrant translocation t(7;9;13;22)(q36;q34;q14;q11) BCR/ABL1
Andrieux et al 2004 Genes Chromosomes Cancer 10383 1 Idiopathic myelofibrosis t(4;12)(q32;q14) HMGA2+
Andrieux et al 2004 Genes Chromosomes Cancer 10383 2 Idiopathic myelofibrosis t(5;12)(p14;q14) HMGA2+
Angelidis et al 2006 Cancer Genet Cytogenet 11463 1 Acute myeloid leukemia, NOS t(19;21)(q13;q22) RUNX1+
Anguita et al 1998 Med Pediatr Oncol 7598 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Antonescu et al 1998 Diagn Mol Pathol 7808 1 Desmoplastic small round cell tumor Soft tissue t(11;22)(p13;q12) EWSR1/WT1
Antonescu et al 1998 Diagn Mol Pathol 7808 2 Desmoplastic small round cell tumor Intrathoracal t(11;22)(p13;q12) EWSR1/WT1
Antonescu et al 2000 Clin Cancer Res 8950 1 Liposarcoma, myxoid/round cell Soft tissue t(12;22)(q13;q12) EWSR1/DDIT3
Antonescu et al 2006 Clin Cancer Res 11707 1 Clear cell sarcoma Small intestine t(2;22)(q33;q12) EWSR1/CREB1
Antonescu et al 2006 Clin Cancer Res 11707 2 Clear cell sarcoma Large intestine t(2;22)(q33;q12) EWSR1/CREB1
Antonescu et al 2007 Genes Chromosomes Cancer 12096 1 Angiomatoid malignant fibrous histiocytoma Soft tissue t(2;22)(q33;q12) EWSR1/CREB1
Antonescu et al 2010 Genes Chromosomes Cancer 13379 1 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue t(6;22)(p21;q12) EWSR1/POU5F1
Antonescu et al 2010 Genes Chromosomes Cancer 13379 2 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue t(1;22)(q23;q12) EWSR1/PBX1
Antonescu et al 2010 Genes Chromosomes Cancer 13379 3 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue t(19;22)(q13;q12) EWSR1/ZNF444
Antunes et al 2001 J Neurooncol 9273 1 Ewing tumor/peripheral primitive neuroectodermal tumor Brain t(11;22)(q24;q12) EWSR1/FLI1
Anzick et al 2010 Genes Chromosomes Cancer 13056 1 Mucoepidermoid carcinoma Thyroid t(11;19)(q21;p13) CRTC1/MAML2
Aoki et al 2008 Int J Hematol 12778 1 Acute myelomonocytic leukemia (FAB type M4) t(7;11)(p15;p15) NUP98/HOXA9
Aplan et al 1992 J Exp Med 4506 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;3)(p33;p21) TAL1+
Aplan et al 1995 Cancer Res 5982 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;3)(p33;p21) TCTA/TAL1
Arai et al 1997 Blood 7009 1 Acute myelomonocytic leukemia (FAB type M4) inv(11)(p15q22) NUP98/DDX10
Arai et al 1997 Blood 7009 2 Myelodysplastic syndrome, NOS inv(11)(p15q22) NUP98/DDX10
Arai et al 1997 Blood 7009 3 Acute myeloblastic leukemia without maturation (FAB type M1) inv(11)(p15q22) NUP98/DDX10
Arai et al 2000 Leukemia 8708 1 Acute myelomonocytic leukemia (FAB type M4) t(2;11)(q31;p15) NUP98/HOXD13
Arber et al 2003 Hum Pathol 10324 1 Acute myeloid leukemia, NOS t(3;5)(q25;q35) NPM1/MLF1
Arber et al 2003 Hum Pathol 10324 2 Acute myeloid leukemia, NOS ins(3;5)(q25;q31q35) NPM1/MLF1
Arber et al 2003 Hum Pathol 10324 3 Acute erythroleukemia (FAB type M6) t(3;5)(q25;q35) NPM1/MLF1
Arber et al 2003 Hum Pathol 10324 4 Acute myelomonocytic leukemia (FAB type M4) ins(3;5)(q25;q31q35) NPM1/MLF1
Archimbaud et al 1998 Leukemia 7283 1 Acute myeloid leukemia, NOS t(11;15)(q23;q14) MLL+
Argani et al 2000 Am J Surg Pathol 8798 1 Synovial sarcoma Kidney t(X;18)(p11;q11) SS18/SSX1
Argani et al 2000 Am J Surg Pathol 8798 2 Synovial sarcoma Kidney t(X;18)(p11;q11) SS18/SSX2
Argani et al 2001 Am J Pathol 9265 1 Malignant epithelial tumor, special type Kidney t(X;17)(p11;q25) ASPSCR1/TFE3
Argani et al 2003 Oncogene 10342 1 Adenocarcinoma Kidney t(X;17)(p11;q23) CLTC/TFE3
Ariyama et al 1998 Genes Chromosomes Cancer 7644 1 Acute monoblastic leukemia without differentiation (FAB type M5a) dmin +MLL+
Arnaud et al 2004 Cancer Genet Cytogenet 10651 1 Acute myelomonocytic leukemia (FAB type M4) ins(11;X)(q23;q28q12) MLL+
Arnaud et al 2005 Cancer Genet Cytogenet 11217 2 Acute myelomonocytic leukemia (FAB type M4) t(1;11)(p32;q23) MLL+
Arnaud et al 2005 Cancer Genet Cytogenet 11217 3 Acute myeloid leukemia, NOS t(11;17)(q23;q21) MLL+
Arnaud et al 2005 Cancer Genet Cytogenet 11217 5 Acute monoblastic leukemia (FAB type M5) ins(X;11)(q2?;q23q23) MLL+
Arnould et al 1999 Hum Mol Genet 12274 1 Acute promyelocytic leukemia (FAB type M3) t(17;17)(q21;q21) STAT5B/RARA
Arranz et al 1996 Cancer Genet Cytogenet 6313 1 Diffuse large B-cell lymphoma hsr +AKT2
Ashar et al 1995 Cell 5953 1 Lipoma Soft tissue t(12;15)(q14;q24) HMGA2+
Ashar et al 1995 Cell 5953 2 Lipoma Soft tissue t(3;12)(q28;q14) HMGA2+
Ashar et al 1995 Cell 5953 3 Lipoma Soft tissue t(12;13)(q14;q21-32) HMGA2+
Asou et al 1994 Br J Haematol 5403 1 Chronic lymphocytic leukemia t(2;18)(p11;q21) IGK@/BCL2
Asou et al 1996 Br J Haematol 6608 1 Chronic myeloid leukemia, aberrant translocation inv(3)(q21q26) EVI1+
Asou et al 1996 Br J Haematol 6608 2 Chronic myeloid leukemia, aberrant translocation t(9;22;11)(q34;q11;q13) BCR/ABL1
Asou et al 2007 Blood 11932 1 Acute myelomonocytic leukemia (FAB type M4) t(8;21)(q23;q22) RUNX1/TRPS1
Asp et al 2006 Genes Chromosomes Cancer 11548 1 Adenoma Salivary gland der(8)(q12q12) CHCHD7/PLAG1
Asp et al 2006 Genes Chromosomes Cancer 11548 2 Adenoma Salivary gland ins(9;12)(p22;q12q14) HMGA2/NFIB
Asp et al 2006 Genes Chromosomes Cancer 11548 3 Adenoma Salivary gland der(8)(q11q12) TCEA1/PLAG1
Asp et al 2006 Genes Chromosomes Cancer 11548 4 Adenoma Salivary gland t(9;12)(p22;q14) HMGA2/NFIB
Attard et al 2008 Br J Cancer 12521 1 Adenocarcinoma Prostate t(2;7)(q36;p21) ACSL3/ETV1
Attard et al 2008 Br J Cancer 12521 2 Adenocarcinoma Prostate t(7;15)(p21;q21) C15ORF21/ETV1
Attard et al 2008 Br J Cancer 12521 3 Adenocarcinoma Prostate t(7;7)(p15;p21) HNRPA2B1/ETV1
Attard et al 2008 Br J Cancer 12521 4 Adenocarcinoma Prostate t(1;7)(q32;p21) SLC45A3/ETV1
Attwooll et al 1999 Oncogene 8626 1 Chondrosarcoma, myxoid Soft tissue t(9;17)(q31;q12) TAF15/NR4A3
Au et al 1999 Br J Haematol 8139 1 Diffuse large B-cell lymphoma t(3;16)(q27;p13) BCL6+
Au et al 1999 Br J Haematol 8139 2 Diffuse large B-cell lymphoma add(8)(q24) MYC+
Au et al 2002 Leuk Lymphoma 9886 1 Diffuse large B-cell lymphoma t(14;19)(q32;q13) IGH@/BCL3
Aurich et al 1997 Genes Chromosomes Cancer 7100 1 Chronic myeloid leukemia, aberrant translocation ins(9;22)(q34;q11q11) BCR/ABL1
Aventin et al 1999 Cancer Genet Cytogenet 7844 1 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(q22;q23) MLL+
Aventin et al 1999 Cancer Genet Cytogenet 7844 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(8;11)(q24;q23) MLL+
Aventin et al 2000 Cancer Genet Cytogenet 8833 1 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(16)(q22p13p13) CBFB/MYH11
Aventin et al 2003 J Clin Pathol 10389 1 Mantle cell lymphoma ins(14;11)(q32;q13q13) IGH@/CCND1
Aventin et al 2008 Cancer Genet Cytogenet 12560 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;14)(q14;q32) IGH@+
Aventin et al 2008 Cancer Genet Cytogenet 12560 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;17)(q32;q21) IGH@+
Avet-Loiseau et al 1998 Cancer Res 7865 2 Plasma cell leukemia t(11;14)(q13;q32) IGH@/CCND1
Avet-Loiseau et al 1998 Cancer Res 7865 3 Plasma cell leukemia t(4;14)(p16;q32) IGH@/FGFR3
Avet-Loiseau et al 1999 Genes Chromosomes Cancer 7805 1 Plasma cell leukemia t(9;14)(p13;q32) IGH@+
Avet-Loiseau et al 1999 Genes Chromosomes Cancer 8132 1 Acute myeloblastic leukemia without maturation (FAB type M1) dmin +MLL
Avet-Loiseau et al 1999 Cancer Res 8365 1 Monoclonal gammopathy of undetermined significance t(11;14)(q13;q32) IGH@/CCND1
Avet-Loiseau et al 1999 Cancer Res 8365 2 Monoclonal gammopathy of undetermined significance t(4;14)(p16;q32) IGH@/FGFR3
Avet-Loiseau et al 2001 Blood 9458 1 Plasma cell leukemia der(8)(q24) MYC+
Avet-Loiseau et al 2001 Blood 9458 2 Multiple myeloma t(8;22)(q24;q11) MYC+
Avet-Loiseau et al 2002 Blood 9469 1 Monoclonal gammopathy of undetermined significance t(8;14)(q24;q32) IGH@/MYC
Avet-Loiseau et al 2002 Blood 9469 2 Monoclonal gammopathy of undetermined significance t(14;16)(q32;q23) IGH@/MAF
Avet-Loiseau et al 2002 Blood 9469 3 Plasma cell leukemia t(14;16)(q32;q23) IGH@/MAF
Bacher et al 2010 Cancer Genet Cytogenet 13282 1 Chronic lymphocytic leukemia t(4;14)(p16;q32) IGH@/FGFR3
Backer et al 1998 Virchows Arch 7325 1 Desmoplastic small round cell tumor Intrathoracal t(11;22)(p13;q22) EWSR1/WT1
Bae et al 2008 Leuk Lymphoma 12632 1 Acute myelomonocytic leukemia (FAB type M4) dmin +MYC
Bae et al 2008 Leuk Lymphoma 12632 2 Acute myelomonocytic leukemia (FAB type M4) hsr(1)(p32) +MLL
Baens et al 2000 Genes Chromosomes Cancer 8753 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;18)(q22;q21) BIRC3/MALT1
Baer et al 1985 Cell 2084 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(14)(q11q32) IGH@/TRA@
Baer et al 1987 Proc Natl Acad Sci U S A 2351 1 T-prolymphocytic leukemia inv(14)(q11q32) TRA@+
Baer et al 1998 Leukemia 7253 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;17)(q23;q25) MLL+
Baer et al 1998 Leukemia 7253 2 Acute monoblastic leukemia with differentiation (FAB type M5b) t(9;11)(p21;q23) MLL+
Baer et al 1998 Leukemia 7253 3 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;17)(q23;q11) MLL+
Bain et al 1998 Leukemia 7526 1 Myelodysplastic syndrome, NOS t(9;11)(p21;q23) MLL/MLLT3
Bakhshi et al 1985 Cell 1980 1 Mature B-cell neoplasm, NOS t(14;18)(q32;q21) IGH@+
Bakshi et al 2009 Cancer Genet Cytogenet 12725 1 Chronic myeloid leukemia, aberrant translocation t(5;9;10;22)(q13;q34;p?;q11) BCR/ABL1
Balatzenko et al 2004 Ann Hematol 11073 1 Acute megakaryoblastic leukemia (FAB type M7) t(9;22)(q34;q11) BCR/ABL1
Baldazzi et al 2010 Leuk Res 13342 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;22)(p11;q11) BCR/FGFR1
Balgobind et al 2009 Haematologica 13006 1 Acute monoblastic leukemia (FAB type M5) inv(11)(p15q23) MLL/NRIP3
Ballerini et al 2005 Leukemia 11145 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(2;9)(q23-24;q34q34) +NUP214/ABL1
Barber et al 2004 Genes Chromosomes Cancer 10742 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(9;11)(p2?;q23q23) MLL+
Barber et al 2004 Genes Chromosomes Cancer 10742 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(11)(q23q23-25) MLL+
Barber et al 2007 Genes Chromosomes Cancer 11817 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;19)(p13;p13) TCF3+
Barber et al 2007 Genes Chromosomes Cancer 11817 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(13;19)(q14;p13) TCF3+
Barbouti et al 2002 Genes Chromosomes Cancer 9703 1 Chronic myeloid leukemia, t(9;22) t(9;11)(p21-22;q23) MLL+
Barbouti et al 2003 Cancer Res 10009 1 Chronic myeloid leukemia, t(9;22) t(7;17)(p15;q22) MSI2/HOXA9
Barbouti et al 2003 Cancer Res 10009 2 Chronic myeloid leukemia, t(9;22) t(7;17)(q32-34;q22) MSI2+
Barbouti et al 2003 Br J Haematol 10263 1 Atypical chronic myeloid leukemia ins(12;9)(p13;q34q34) ETV6/ABL1
Baro et al 2006 Haematologica 11686 1 Splenic marginal zone B-cell lymphoma t(9;14)(p13;q32) IGH@/PAX5
Baron et al 1993 Proc Natl Acad Sci U S A 4929 1 Mature B-cell neoplasm, NOS t(3;14)(q27;q32) IGH@/BCL6
Baron et al 1993 Proc Natl Acad Sci U S A 4929 2 Mature B-cell neoplasm, NOS t(3;22)(q27;q11) IGL@/BCL6
Barr et al 1993 Nat Genet 4625 1 Alveolar rhabdomyosarcoma Soft tissue t(2;13)(q36;q14) PAX3+
Barr et al 1996 Hum Mol Genet 6200 1 Alveolar rhabdomyosarcoma Soft tissue t(1;13)(p36;q14) PAX7/FOXO1
Barr et al 1996 Hum Mol Genet 6200 2 Alveolar rhabdomyosarcoma Soft tissue dmin +PAX7/FOXO1
Barr et al 2002 Cancer Res 10449 1 Alveolar rhabdomyosarcoma Unknown site t(X;2)(q13;q36) PAX3/FOXO4
Bartram 1988 Leukemia 2253 1 Acute myeloid leukemia, NOS t(9;22)(q34;q11) BCR/ABL1
Bartram et al 1983 Nature 1902 1 Chronic myeloid leukemia, aberrant translocation t(9;11;22)(q34;q12;q11) ABL1+
Bartram et al 1983 Nature 1902 2 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p32;q34;q11) ABL1+
Bartuma et al 2007 Genes Chromosomes Cancer 11858 1 Lipoma Soft tissue t(1;6;5)(p35;p21;p13) HMGA1+
Bartuma et al 2007 Genes Chromosomes Cancer 11858 2 Lipoma Soft tissue t(1;6)(p32;p21) HMGA1+
Bartuma et al 2007 Genes Chromosomes Cancer 11858 3 Lipoma Soft tissue t(2;8)(q32-33;q12) PLAG1+
Bartuma et al 2007 Genes Chromosomes Cancer 11858 4 Lipoma Soft tissue t(10;12)(q22;q14) HMGA2+
Bartuma et al 2007 Genes Chromosomes Cancer 11858 5 Lipoma Soft tissue del(12)(q14q21) HMGA2+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 1 Lipoblastoma Soft tissue t(1;8)(p13;q12) PLAG1+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 2 Lipoblastoma Soft tissue t(8;8)(q12;q24) PLAG1+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 3 Lipoblastoma Soft tissue t(8;11)(q12;p15) PLAG1+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 4 Lipoblastoma Soft tissue t(1;8;3)(p13-22;q12;q13) PLAG1+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 5 Lipoblastoma Soft tissue t(2;8;6)(q32;q12;p11) PLAG1+
Bartuma et al 2008 Cancer Genet Cytogenet 12454 6 Lipoblastoma Soft tissue del(8)(q12q22) PLAG1+
Bartuma et al 2009 Mol Cancer 12980 1 Lipoma Soft tissue ins(12;5)(q14;q33q13) HMGA2+
Bartuma et al 2009 Mol Cancer 12980 2 Lipoma Soft tissue inv(12)(q14q24) HMGA2+
Bartuma et al 2009 Mol Cancer 12980 3 Lipoma Soft tissue t(1;12)(p32;q14) HMGA2+
Bartuma et al 2009 Mol Cancer 12980 4 Lipoma Soft tissue t(10;12)(q22;q15) HMGA2+
Bartuma et al 2009 Mol Cancer 12980 5 Atypical lipomatous tumor/atypical lipoma/well-differentiated liposarcoma Soft tissue +r +HMGA2+
Bartuma et al 2010 Cancer Genet Cytogenet 13232 1 Fibromyxoid sarcoma Lung r(7;16)(q34;p11) FUS/CREB3L2
Basecke et al 2002 Blood 9818 1 Nonneoplastic myeloid disorder/lesion t(8;21)(q22;q22) RUNX1/RUNX1T1
Bash et al 1993 Blood 4892 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(1)(p33) TAL1+
Batanian et al 2002 Cancer Genet Cytogenet 9402 1 Ewing tumor/peripheral primitive neuroectodermal tumor Intrathoracal ins(11;22)(q24;q12q12) EWSR1/FLI1
Battey et al 1983 Cell 4505 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) IGH@/MYC
Baumann Kreuziger et al 2007 Leuk Res 12017 1 Refractory anemia with excess blasts-1 t(11;17)(q23;q25) MLL/SEPT9
Baxter et al 2002 Hum Mol Genet 9620 1 Atypical chronic myeloid leukemia t(4;22)(q12;q11) BCR/PDGFRA
Baxter et al 2003 Br J Haematol 10091 1 Chronic myeloproliferative disorder, NOS t(1;5)(q21;q32) PDGFRB+
Baxter et al 2003 Br J Haematol 10091 2 Atypical chronic myeloid leukemia t(1;5)(q22;q32) PDGFRB+
Baxter et al 2003 Br J Haematol 10091 3 Chronic myeloproliferative disorder, NOS t(1;3;5)(p36;p21;q32) PDGFRB+
Baxter et al 2003 Br J Haematol 10091 4 Myelodysplastic syndrome, NOS t(2;12;5)(q37;q22;q32) PDGFRB+
Baxter et al 2003 Br J Haematol 10091 5 Atypical chronic myeloid leukemia t(3;5)(p21;q32) PDGFRB+
Baxter et al 2003 Br J Haematol 10091 6 Atypical chronic myeloid leukemia t(5;14)(q32;q24) PDGFRB+
Begley et al 1989 Proc Natl Acad Sci U S A 2909 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p33;q11) TRD@+
Behboudi et al 2005 Genes Chromosomes Cancer 10900 1 Benign epithelial tumor, special type Skin t(11;19)(q21;p13) CRTC1/MAML2
Behboudi et al 2006 Genes Chromosomes Cancer 11337 1 Mucoepidermoid carcinoma Lung t(11;19)(q21;p13) CRTC1/MAML2
Behboudi et al 2006 Genes Chromosomes Cancer 11337 2 Mucoepidermoid carcinoma Oral cavity t(11;22;16;19)(q21;q11;p13;p13) CRTC1/MAML2
Behboudi et al 2006 Genes Chromosomes Cancer 11337 3 Mucoepidermoid carcinoma Nasopharynx t(11;19)(q21;p13) CRTC1/MAML2
Behm et al 1996 Blood 6342 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;19;11)(q33;p13;q23) MLL+
Behm et al 1996 Blood 6342 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(11)(q23) MLL+
Behm et al 1996 Blood 6342 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;12)(q23;p13) MLL+
Bell et al 2008 Genes Chromosomes Cancer 12264 1 Warthin tumor Salivary gland t(11;19)(q21;p13) CRTC1/MAML2
Bellido et al 2003 Haematologica 10729 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;14)(p22;q32) IGH@/ID4
Belloni et al 2004 Genes Chromosomes Cancer 10741 1 Acute megakaryoblastic leukemia (FAB type M7) t(5;12)(q13;p13) ETV6+,FCHO2+
Belloni et al 2004 Genes Chromosomes Cancer 10741 2 Acute megakaryoblastic leukemia (FAB type M7) der(12)t(12;22)(p13;q12)ins(22;3)(q12;?) ETV6+,MN1+
Belloni et al 2004 Genes Chromosomes Cancer 10741 3 Acute megakaryoblastic leukemia (FAB type M7) t(5;22)(q13;q12) FCHO2+,MN1+
Belloni et al 2005 Genes Chromosomes Cancer 10784 1 Acute myelomonocytic leukemia (FAB type M4) t(7;8)(q34;p11) TRIM24/FGFR1
Benitez et al 1992 Cancer Genet Cytogenet 4222 1 Mature B-cell neoplasm, NOS add(14)(q32) IGH@+
Benitez et al 1992 Cancer Genet Cytogenet 4222 2 Diffuse large B-cell lymphoma t(3;14)(p21;q32) IGH@+
Benitez et al 1992 Cancer Genet Cytogenet 4222 3 Diffuse large B-cell lymphoma add(14)(q32) IGH@+
Benitez et al 1992 Cancer Genet Cytogenet 4222 4 Diffuse large B-cell lymphoma t(14;18)(q32;q21) IGH@/BCL2
Benn et al 1987 Cancer Genet Cytogenet 2266 1 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(q26;q34;q11) BCR+
Bennour et al 2009 Cancer Genet Cytogenet 12983 1 Chronic myeloid leukemia, aberrant translocation t(9;7;22)(q34;p21;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 2 Chronic myeloid leukemia, aberrant translocation t(9;21;22)(q34;q22;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 3 Chronic myeloid leukemia, aberrant translocation t(11;9;22)(q12;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 4 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(q22;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 5 Chronic myeloid leukemia, aberrant translocation t(X;9;22)(p22;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 6 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(p14;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 7 Chronic myeloid leukemia, aberrant translocation t(9;13;22)(q34;q13;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 8 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q27;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 9 Chronic myeloid leukemia, aberrant translocation t(9;12;12;22)(q34;q21;p12;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 10 Chronic myeloid leukemia, aberrant translocation t(10;9;22)(q25;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 11 Chronic myeloid leukemia, aberrant translocation t(9;17;22)(q34;q23;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 12 Chronic myeloid leukemia, aberrant translocation t(1;1;2;9;12;13;22)(q24;q31;p21;q34;p12;p12;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 13 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q13;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 14 Chronic myeloid leukemia, aberrant translocation t(9;17;22)(q34;q22;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 15 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(q21;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 16 Chronic myeloid leukemia, aberrant translocation t(9;12;22)(q34;p13;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 17 Chronic myeloid leukemia, aberrant translocation t(9;12;22)(q34;q13;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 18 Chronic myeloid leukemia, aberrant translocation t(1;1;9;22)(p34;q42;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 19 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q34;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 20 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p35;q34;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 21 Chronic myeloid leukemia, aberrant translocation t(9;19;22)(q34;q13;q11) BCR/ABL1
Bennour et al 2009 Cancer Genet Cytogenet 12983 22 Chronic myeloid leukemia, aberrant translocation t(9;13;22)(q34;q31;q11) BCR/ABL1
Bentley et al 2005 Cancer Genet Cytogenet 10821 1 Follicular lymphoma t(18;22)(q21;q11) BCL2+
Bentley et al 2005 Cancer Genet Cytogenet 10821 2 Follicular lymphoma t(9;14;18)(p13;q32;q21) BCL2+
Bentley et al 2005 Cancer Genet Cytogenet 10821 3 Follicular lymphoma t(14;18;22)(q32;q21;q11) BCL2+
Bentley et al 2005 Cancer Genet Cytogenet 10821 4 Follicular lymphoma t(2;14;18)(p11;q32;q21) BCL2+
Berg et al 2009 Cancer Genet Cytogenet 12988 1 Ewing tumor/peripheral primitive neuroectodermal tumor Kidney t(16;21)(p11;q22) FUS/ERG
Berger et al 1993 Cancer Genet Cytogenet 5106 1 Myelodysplastic syndrome, NOS t(8;21)(q22;q22) RUNX1+
Berger et al 1996 Cancer Genet Cytogenet 6229 1 Burkitt lymphoma/leukemia del(8)(q24) MYC+
Berger et al 1996 Ann Genet 6759 1 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(10;11)(p12;q23q23) MLL+
Berger et al 1996 Hematol Cell Ther 9307 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(16;21)(q24;q22) RUNX1+
Berger et al 1997 Leukemia 7169 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;12)(p23-24;p13) ETV6+
Berger et al 1997 Leukemia 7169 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(12)(p13) ETV6+
Berger et al 1997 Leukemia 7169 3 Acute myeloid leukemia, NOS del(12)(p13) ETV6+
Berger et al 1997 Leukemia 7169 4 Acute myeloblastic leukemia with maturation (FAB type M2) t(1;12)(q21;p13) ETV6+
Berger et al 2006 Leukemia 11688 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(3;5)(q25;q35) NPM1/MLF1
Berger et al 2006 Leukemia 11688 2 Acute myeloid leukemia, NOS t(3;5)(q25;q35) NPM1/MLF1
Berger et al 2006 Leukemia 11688 3 Acute myelomonocytic leukemia (FAB type M4) t(3;5)(q25;q35) NPM1/MLF1
Bergsagel et al 1996 Proc Natl Acad Sci U S A 6783 1 Multiple myeloma t(4;14)(p16;q32) IGH@+
Bergsagel et al 1996 Proc Natl Acad Sci U S A 6783 2 Multiple myeloma t(8;14)(q24;q32) IGH@+
Bergsagel et al 1996 Proc Natl Acad Sci U S A 6783 3 Multiple myeloma t(14;21)(q32;q22) IGH@+
Bergsagel et al 1996 Proc Natl Acad Sci U S A 6783 4 Multiple myeloma t(14;16)(q32;q23) IGH@+
Bernard et al 1990 Genes Chromosomes Cancer 3289 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p33;q11) TRD@/TAL1
Bernard et al 1991 Oncogene 4005 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(1)(p33p33) STIL/TAL1
Bernard et al 1993 Leukemia 5161 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(7)(p14q34) TRB@/TRG@
Bernard et al 1993 Leukemia 5162 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p33;q11) TRD@/TAL1
Bernard et al 1994 Oncogene 5300 1 Bilineage or biphenotypic leukemia t(1;11)(p32;q23) MLL/EPS15
Bernard et al 1994 Oncogene 5300 2 Acute monoblastic leukemia (FAB type M5) t(1;11)(p32;q23) MLL/EPS15
Bernard et al 1995 Leukemia 6118 2 Acute myeloblastic leukemia without maturation (FAB type M1) der(11)(q23) MLL+
Bernard et al 1998 Genes Chromosomes Cancer 7465 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(6;11)(q21;q23) MLL/FOXO3
Bernard et al 2001 Leukemia 9445 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;14)(q35;q32) BCL11B/TLX3
Bernardino et al 1998 Genes Chromosomes Cancer 7667 1 Adenocarcinoma Breast hsr +ERBB2
Bernardino et al 1998 Genes Chromosomes Cancer 7667 2 Adenocarcinoma Breast hsr +CCND1,+LRRC32,+CTTN
Bernardino et al 1998 Genes Chromosomes Cancer 7667 3 Adenocarcinoma Breast hsr +CCND1,+LRRC32,+CTTN,+FGFR1
Bernardino et al 1998 Genes Chromosomes Cancer 7667 4 Adenocarcinoma Breast hsr +CTTN,+FGFR1
Bernasconi et al 1999 Leukemia 7893 1 Acute myelomonocytic leukemia (FAB type M4) t(Y;11)(p11;q23) MLL+
Bernasconi et al 2000 Haematologica 8978 1 Acute myelomonocytic leukemia (FAB type M4) t(8;16)(p11;p13) MYST3+,CREBBP+
Bernicot et al 2006 Cancer Genet Cytogenet 11648 1 Splenic marginal zone B-cell lymphoma t(4;14)(p14;q32) IGH@/RHOH
Bertheas et al 1991 Br J Haematol 3938 1 Follicular lymphoma t(2;18)(p11;q21) IGK@/BCL2
Bertness et al 1990 Cancer Genet Cytogenet 3196 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;14)(q11;q32) TRA@+
Bertrand et al 2007 Leukemia 11886 1 Diffuse large B-cell lymphoma t(8;9)(q24;p13) MYC/ZBTB5
Bertrand et al 2007 Leukemia 11886 2 Diffuse large B-cell lymphoma t(8;9)(q24;p13) MYC/ZCCHC7
Beverloo et al 2001 Cancer Res 9243 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(7;12)(q36;p13) MNX1/ETV6
Beverloo et al 2001 Cancer Res 9243 2 Acute promyelocytic leukemia (FAB type M3) t(7;12)(q36;p13) MNX1/ETV6
Beylot-Barry et al 1998 Blood 7559 1 Mycosis fungoides/Sezary syndrome t(2;5)(p23;q35) NPM1/ALK
Beylot-Barry et al 1998 Blood 7559 2 Peripheral T-cell lymphoma, unspecified t(2;5)(p23;q35) NPM1/ALK
Beylot-Barry et al 1998 Blood 7559 3 Nonneoplastic lymphatic disorder/lesion t(2;5)(p23;q35) NPM1/ALK
Bianchini et al 2008 Virchows Arch 12574 1 Dermatofibrosarcoma protuberans/Bednar tumor/giant cell fibroblastoma Soft tissue t(5;8)(q14;p21) VCAN+,PTK2B+
Biernaux et al 1995 Blood 11638 1 Nonneoplastic myeloid disorder/lesion t(9;22)(q34;q11) BCR/ABL1
Biggerstaff et al 2006 Leukemia 11714 1 Myelodysplastic syndrome, NOS t(11;19)(q23;p13) MLL/ELL
Biggerstaff et al 2006 Leukemia 11714 2 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;19)(q23;p13) MLL/ELL
Biggerstaff et al 2006 Leukemia 11714 3 Chronic myeloproliferative disorder, NOS t(11;19)(q23;p13) MLL/ELL
Bigoni et al 1996 Oncogene 6646 1 Mantle cell lymphoma del(11)(q13q2?1) CCND1+
Billio et al 2002 Haematologica 10280 1 Acute monoblastic leukemia without differentiation (FAB type M5a) inv(8)(p11q13) MYST3/NCOA2
Biondi et al 1993 Blood 5158 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL/AFF1
Birch et al 2003 J Mol Diagn 10434 1 Liposarcoma, myxoid/round cell Soft tissue ins(22;12)(q12;q13q14) EWSR1/DDIT3
Bischof et al 1997 Mol Cell Biol 6964 1 Mature B-cell neoplasm, NOS t(2;5)(p23;q35) NPM1/ALK
Bisig et al 2009 Hum Pathol 12991 1 Extranodal marginal zone B-cell lymphoma Gallbladder/Biliary system t(11;18)(q22;q21) BIRC3/MALT1
Blanco et al 2001 Proc Natl Acad Sci U S A 9371 1 Acute myelomonocytic leukemia (FAB type M4) t(11;19)(q23;p13) MLL/MLLT1
Blank et al 2001 Cytogenet Cell Genet 9551 1 Chondroid hamartoma Lung t(6;14)(p21;q24) RAD51L1+
Blütters-Sawatzki et al 1995 Ann Hematol 5842 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(4;11)(q21;q23) MLL/AFF1
Boehm et al 1988 EMBO J 2558 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRD@+
Boehm et al 1988 EMBO J 2559 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p15;q11) TRA@+
Boehm et al 1989 EMBO J 3285 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRD@+
Boehm et al 1989 EMBO J 3285 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;10)(q34;q24) TRB@+
Boehm et al 1991 Proc Natl Acad Sci U S A 3874 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) LMO2+
Boersma-Vreugdenhil et al 2004 Br J Haematol 10703 1 Multiple myeloma t(14;20)(q32;q12) IGH@/MAFB
Bogusz et al 2009 Am J Clin Pathol 12992 1 Mature B-cell neoplasm, special type t(8;14)(q24;q32) IGH@/MYC
Bohlander et al 2000 Leukemia 8406 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(p12;q14) PICALM/MLLT10
Boils & Mohamed 2008 Acta Haematol 12443 1 Acute myelomonocytic leukemia (FAB type M4) t(16;21)(q24;q22) RUNX1+
Bol et al 1996 Cancer Genet Cytogenet 6498 1 Benign epithelial tumor, special type Uterus, corpus t(2;12)(q21;q14) HMGA2+
Bongarzone et al 1993 Mol Cell Biol 9698 1 Adenocarcinoma Thyroid t(10;17)(q11;q24) PRKAR1A/RET
Bonin et al 1993 Cancer Res 4987 1 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22;14)(q24;q12;q11) EWSR1/FLI1
Bonin et al 1993 Cancer Res 4987 2 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Bonomi et al 2000 Cancer Genet Cytogenet 8842 1 Acute promyelocytic leukemia (FAB type M3) t(8;21)(q22;q22) RUNX1/RUNX1T1
Borkhardt et al 1995 Leukemia 6355 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(10;11)(p12;q23) MLL/MLLT10
Borkhardt et al 1995 Leukemia 6355 2 Acute megakaryoblastic leukemia (FAB type M7) t(10;11)(p12;q23) MLL/MLLT10
Borkhardt et al 1997 Oncogene 6879 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(X;11)(q13;q23) MLL/FOXO4
Borkhardt et al 1997 Oncogene 6879 2 Acute myeloid leukemia, NOS t(X;11)(q13;q23) MLL/FOXO4
Borkhardt et al 2000 Proc Natl Acad Sci U S A 8935 1 Juvenile myelomonocytic leukemia t(5;11)(q31;q23) MLL/ARHGAP26
Borkhardt et al 2000 Proc Natl Acad Sci U S A 8935 2 Acute myeloid leukemia, NOS der(5)(q31) ARHGAP26+
Borkhardt et al 2000 Proc Natl Acad Sci U S A 8935 3 Acute myeloid leukemia, NOS del(5)(q13q31) ARHGAP26+
Borkhardt et al 2001 Genes Chromosomes Cancer 9127 1 Acute myeloblastic leukemia with maturation (FAB type M2) ins(X;11)(q24;q23q23) MLL/SEPT6
Boroumand et al 2003 Arch Pathol Lab Med 10025 1 Synovial sarcoma Lung t(X;18)(p11;q11) SS18/SSX2
Borrow et al 1990 Science 3512 1 Acute promyelocytic leukemia (FAB type M3) t(15;17)(q22;q21) RARA+
Borrow et al 1996 Nat Genet 6202 1 Acute myeloid leukemia, NOS t(7;11)(p15;p15) NUP98/HOXA9
Borrow et al 1996 Nat Genet 6477 1 Acute myeloid leukemia, NOS t(8;16)(p11;p13) MYST3/CREBBP
Bose et al 1998 Blood 7914 1 Nonneoplastic myeloid disorder/lesion t(9;22)(q34;q11) BCR/ABL1
Bouayed Abdelmoula et al 2000 Cancer Genet Cytogenet 8868 1 Chronic myeloid leukemia, aberrant translocation t(9;22;22)(q34;q11;q13) BCR/ABL1
Bouchireb et al 2008 Pediatr Blood Cancer 12548 1 Desmoplastic small round cell tumor Brain t(11;22)(p13;q12) EWSR1/WT1
Bousquet et al 2005 Oncogene 11201 1 Atypical chronic myeloid leukemia t(8;9)(p22;p24) PCM1/JAK2
Bousquet et al 2007 Blood 11898 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q11;p13) PAX5/ELN
Bower et al 1994 Leukemia 5352 1 Acute myelomonocytic leukemia (FAB type M4) der(11)(q23) MLL+
Bower et al 1994 Leukemia 5352 2 Acute monoblastic leukemia (FAB type M5) der(11)(q23) MLL+
Bower et al 1994 Blood 5718 1 Acute myelomonocytic leukemia (FAB type M4) del(11)(q23q25) MLL+
Bower et al 1994 Blood 5718 2 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12;q23) MLL+
Bower et al 1994 Blood 5718 3 Acute monoblastic leukemia (FAB type M5) der(11)(q23) MLL+
Bradley et al 1993 Genes Chromosomes Cancer 4803 1 Diffuse large B-cell lymphoma t(8;22)(q24;q11) IGL@/MYC
Bralten et al 2010 Genes Chromosomes Cancer 13190 1 Astrocytoma, grade III-IV Brain t(15;15)(q21;q21) LEO1/SLC12A1
Brambillasca et al 1999 Leukemia 7897 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(19;19)(p13;q13) TCF3/TFPT
Brandal et al 2006 J Pathol 11318 1 Atypical lipomatous tumor/atypical lipoma/well-differentiated liposarcoma Soft tissue t(1;8)(p31;q12) PLAG1+
Brandal et al 2008 Genes Chromosomes Cancer 12390 1 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue t(1;22)(q23;q12) EWSR1/PBX1
Brandal et al 2009 Genes Chromosomes Cancer 13012 1 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue t(19;22)(q13;q12) EWSR1/ZNF444
Breit et al 1993 J Exp Med 4891 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(1)(p33p33) STIL/TAL1
Brennscheidt et al 1994 Leukemia 5528 1 B-prolymphocytic leukemia t(1;8)(p35;q24) MYC+
Brichard et al 2007 Leuk Res 12280 1 Chronic myelomonocytic leukemia t(9;11)(p22;q23) MLL+
Bridge et al 2001 Am J Pathol 9288 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Soft tissue t(2;17)(p23;q23) CLTC/ALK
Brito-Babapulle et al 1984 Int J Cancer 1278 1 B-prolymphocytic leukemia t(2;13)(p11;p11) IGK@+
Brito-Babapulle et al 1984 Int J Cancer 1278 2 B-prolymphocytic leukemia der(14)(q32) IGH@+
Brito-Babapulle et al 1991 Leukemia 3783 1 Burkitt lymphoma/leukemia t(14;18)(q32;q21) IGH@/BCL2
Broberg et al 1999 Genes Chromosomes Cancer 7882 1 Nonneoplastic mesenchymal disorder/lesion Soft tissue t(12;13)(q14;q32) HMGA2+
Broberg et al 1999 Genes Chromosomes Cancer 7882 2 Nonneoplastic mesenchymal disorder/lesion Soft tissue t(X;12)(q26;q14) HMGA2+
Broberg et al 2002 Int J Oncol 9888 1 Lipoma Soft tissue t(2;12)(q37;q14) HMGA2/CXCR7
Brodie et al 1995 Hum Pathol 6272 1 Desmoplastic small round cell tumor Intraabdominal t(11;22)(p13;q12) EWSR1/WT1
Browett et al 1989 Cancer Genet Cytogenet 2791 1 Chronic myeloid leukemia, aberrant translocation t(11;22)(p15;q11) BCR+
Browett et al 1989 Cancer Genet Cytogenet 2791 2 Chronic myeloid leukemia, aberrant translocation t(9;11;22)(q34;q13;q11) BCR+
Browett et al 1989 Cancer Genet Cytogenet 2791 3 Chronic myeloid leukemia, aberrant translocation t(9;14;22)(q34;q24;q11) BCR+
Browett et al 1989 Cancer Genet Cytogenet 2791 4 Chronic myeloid leukemia, aberrant translocation t(10;22)(q26;q11) BCR+
Brown et al 2002 Blood 9625 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(5;11)(q35;p15) NUP98/NSD1
Brown et al 2002 Blood 9625 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(5;11)(q35;p15) NUP98/NSD1
Bruch et al 2003 Genes Chromosomes Cancer 10031 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(11;2)(q23;q11q11) MLL/AFF3
Brunel et al 1995 Genes Chromosomes Cancer 6107 1 Acute promyelocytic leukemia (FAB type M3) t(5;17)(q?;q21) RARA+
Buda et al 2007 Leuk Res 12298 1 Chronic myeloid leukemia, aberrant translocation t(9;10;22)(q34;q24;q11) BCR/ABL1
Buda et al 2008 Leuk Res 12309 1 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(q21;q34;q11) BCR/ABL1
Buijs & Bruin 2007 Leukemia 11931 1 Juvenile myelomonocytic leukemia t(4;17)(q12;q21) FIP1L1/RARA
Buijs et al 1995 Oncogene 5971 1 Acute myelomonocytic leukemia (FAB type M4) t(12;22)(p13;q12) MN1/ETV6
Buijs et al 1995 Oncogene 5971 2 Chronic myeloproliferative disorder, NOS t(12;22)(p13;q12) MN1/ETV6
Buijs et al 1995 Oncogene 5971 3 Refractory anemia with excess of blasts (FAB) t(12;22)(p13;q12) MN1/ETV6
Burchill et al 1997 Eur J Cancer 6993 1 Neuroblastoma Adrenal t(11;22)(q24;q12) EWSR1/FLI1
Burmeister et al 2006 Blood 11750 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma r(9)(q34q34) +NUP214/ABL1
Burmeister et al 2008 Blood Cells Mol Dis 12956 1 Acute myeloid leukemia, NOS t(11;14)(q23;q32) MLL/KIAA0284
Burmeister et al 2009 Blood 12812 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(q21;q23) MLL/TET1
Burmeister et al 2009 Blood 12812 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;q13) MLL/ACTN4
Burnett et al 1991 Genes Chromosomes Cancer 4514 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;7)(p35;q34) TRB@/LCK
Burnett et al 1993 Genes Chromosomes Cancer 4771 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(q23;q11) TRD@+
Busson-Le Coniat et al 1999 Leukemia 7694 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(1;11)(q21;q23) MLL/MLLT11
Busson-Le Coniat et al 1999 Leukemia 7694 2 Acute myelomonocytic leukemia (FAB type M4) t(1;11)(q21;q23) MLL/MLLT11
Busson-Le Coniat et al 1999 Leukemia 7694 3 Acute monoblastic leukemia (FAB type M5) t(1;11)(q21;q23) MLL/MLLT11
Busson-Le Coniat et al 2001 Ann Genet 9181 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(7;21)(q21;q22) RUNX1+
Butler et al 2002 Cancer Res 9653 1 Follicular lymphoma t(3;14)(q27;q32) IGH@/BCL6
Butler et al 2002 Cancer Res 9653 2 Diffuse large B-cell lymphoma t(2;3)(q21;q27) BCL6+
Butler et al 2002 Cancer Res 9653 3 Diffuse large B-cell lymphoma t(3;8)(q27;q13) BCL6+
Butler et al 2002 Cancer Res 9653 4 Diffuse large B-cell lymphoma t(3;9)(q27;p13) BCL6+
Butler et al 2002 Cancer Res 9653 5 Diffuse large B-cell lymphoma t(2;3)(q12;q27) BCL6+
Butler et al 2002 Cancer Res 9653 6 Diffuse large B-cell lymphoma t(3;6;14)(q27;p35;q32) BCL6+
Butti et al 1995 Genomics 9701 1 Adenocarcinoma Thyroid inv(1)(q21q23) TPM3/NTRK1
Byatt et al 2001 Leukemia 9242 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q11;q32) IGH@+
Bärlund et al 2002 Genes Chromosomes Cancer 12265 1 Adenocarcinoma Breast t(17;20)(q23;q13) BCAS4/BCAS3
Calabrese et al 2000 Haematologica 9033 1 Acute myelomonocytic leukemia (FAB type M4) der(11)t(10;11)(p?;q23)inv(11)(p15q23) MLL+
Caligiuri et al 1994 Cancer Res 5307 1 Acute myeloblastic leukemia without maturation (FAB type M1) der(11)(q23) MLL+
Caligiuri et al 1994 Cancer Res 5307 2 Acute myeloblastic leukemia with maturation (FAB type M2) der(11)(q23) MLL+
Callanan et al 2000 Proc Natl Acad Sci U S A 11131 1 Follicular lymphoma t(1;22)(q23;q11) FCGR2B+
Callet-Bauchu et al 2007 Haematologica 12277 1 Mycosis fungoides/Sezary syndrome t(9;22)(q34;q11) BCR/ABL1
Campbell et al 2002 Cancer Genet Cytogenet 9834 1 Chronic myeloid leukemia, t(9;22) hsr +BCR/ABL1
Campbell et al 2008 Nat Genet 12392 1 Undifferentiated carcinoma, small cell Lung t(2;12)(p23;p13) CACNA2D4/WDR43
Campbell et al 2008 Nat Genet 12392 2 Undifferentiated carcinoma, small cell Lung t(8;8)(q12;q24) PVT1/CHD7
Campiotti et al 2008 Leuk Lymphoma 12435 1 Acute myeloid leukemia, NOS t(11;22)(q23;q11) MLL+
Carapeti et al 1998 Blood 7516 1 Acute monoblastic leukemia (FAB type M5) inv(8)(p11q13) MYST3/NCOA2
Carapeti et al 1999 Cancer Genet Cytogenet 8188 1 Acute myelomonocytic leukemia (FAB type M4) inv(8)(p11q13) MYST3/NCOA2
Care et al 1986 EMBO J 1681 2 Diffuse large B-cell lymphoma t(8;14)(q24;q32) IGH@/MYC
Carlson et al 2000 Leukemia 8405 1 Acute myeloid leukemia, NOS t(10;11)(p12;q14) PICALM/MLLT10
Carlson et al 2000 Leukemia 8405 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(p12;q14) PICALM/MLLT10
Carter et al 1991 Cancer Genet Cytogenet 3798 1 Bilineage or biphenotypic leukemia t(14;19)(q32;q13) IGH@/BCL3
Cascavilla et al 2000 Leuk Lymphoma 8565 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(9;22)(q34;q11) BCR/ABL1
Catalano et al 2007 Blood 12230 1 Acute promyelocytic leukemia (FAB type M3) t(17;17)(q21;q24) PRKAR1A/RARA
Cauwelier et al 2006 Leukemia 12133 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(7)(q34) TRB@+
Cauwelier et al 2006 Leukemia 12133 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;14)(q22;q11) TRA@+
Cauwelier et al 2006 Leukemia 12133 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;20)(q11;p12) TRA@+
Cazzaniga et al 1999 Blood 11071 1 Acute myelomonocytic leukemia (FAB type M4) t(1;12)(q25;p13) ETV6/ABL2
Cazzaniga et al 2001 Cancer Res 9200 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;12)(p13;p13) PAX5/ETV6
Cerretini et al 2006 Eur J Haematol 11428 1 Diffuse large B-cell lymphoma t(9;22)(q34;q11) BCR/ABL1
Cerveira et al 2006 Oncogene 11670 1 Acute myelomonocytic leukemia (FAB type M4) t(2;11)(q37;q23) MLL/SEPT2
Cerveira et al 2006 Neoplasia 11733 1 Malignant epithelial tumor, special type Prostate t(21;21)(q22;q22) TMPRSS2/ERG
Cerveira et al 2006 Neoplasia 11733 2 Adenocarcinoma Prostate t(21;21)(q22;q22) TMPRSS2/ERG
Cerveira et al 2008 Haematologica 12598 1 Acute myeloid leukemia, NOS t(X;11)(q24;q23) MLL/SEPT6
Cerveira et al 2008 Haematologica 12598 2 Acute myeloid leukemia, NOS ins(X;11)(q24;q13q23) MLL/SEPT6
Chae et al 2010 Cancer Genet Cytogenet 13440 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma hsr(12)(p13) +ETV6
Chaffanet et al 1998 Oncogene 11140 1 Acute myeloid leukemia, NOS t(6;8)(q27;p11) FGFR1+
Chaffanet et al 1998 Oncogene 11140 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(6;8)(q27;p11) FGFR1+
Chaffanet et al 1998 Oncogene 11140 3 Chronic myeloproliferative disorder, NOS t(8;9)(p11;q33) FGFR1+
Chaffanet et al 1998 Oncogene 11140 4 Acute myeloid leukemia, NOS t(8;13)(p11;q12) FGFR1+
Chaffanet et al 1998 Oncogene 11140 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;13)(p11;q12) FGFR1+
Chaffanet et al 1999 Genes Chromosomes Cancer 8131 1 Acute monoblastic leukemia (FAB type M5) t(8;16)(p11;p13) MYST3+,CREBBP+
Chaffanet et al 2000 Genes Chromosomes Cancer 8521 1 Acute monoblastic leukemia (FAB type M5) t(8;22)(p11;q13) MYST3/EP300
Chaganti et al 1998 Genes Chromosomes Cancer 7705 1 Follicular lymphoma t(3;14)(q27;q32) BCL6+
Chaganti et al 1998 Genes Chromosomes Cancer 7705 2 Follicular lymphoma t(3;22)(q27;q11) BCL6+
Chaganti et al 1998 Genes Chromosomes Cancer 7705 3 Follicular lymphoma t(1;3)(q21;q27) BCL6+
Chaganti et al 1998 Genes Chromosomes Cancer 7705 4 Follicular lymphoma t(2;3)(q21;q27) BCL6+
Chaganti et al 1998 Genes Chromosomes Cancer 7705 5 Follicular lymphoma t(3;9)(q27;p13) BCL6+
Chaganti et al 1998 Genes Chromosomes Cancer 7705 6 Follicular lymphoma der(3)(q27) BCL6+
Chami et al 2002 Cancer Genet Cytogenet 9503 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(11;4)(q23;q21q24) MLL/AFF1
Champagne et al 1989 Blood 2890 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRD@+
Chan et al 1987 Nature 1959 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR/ABL1
Chan et al 2005 Blood 11464 1 Refractory anemia with excess blasts-1 t(X;8;21)(p22;q23;q22) RUNX1/ZFPM2
Chang et al 1993 Oncogene 4814 1 Acute myeloid leukemia, NOS t(8;21)(q22;q22) RUNX1/RUNX1T1
Chapiro et al 2006 Blood 11749 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;19)(q32;q13) IGH@/CEBPA
Chapiro et al 2010 Leukemia 13358 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(q24;q32) IGH@/MIR125B1
Chaplin et al 1995 Blood 5856 1 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12;q23) MLL/MLLT10
Chaplin et al 1995 Blood 5856 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(9;11;10)(q33;q23;p12) MLL/MLLT10
Chaplin et al 1995 Blood 6136 1 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12;q23) MLL/MLLT10
Chaplin et al 1995 Blood 6136 2 Acute monoblastic leukemia (FAB type M5) t(9;11;10)(q33;q23;p12) MLL/MLLT10
Chaplin et al 1995 Blood 6136 3 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(p12;q23) MLL/MLLT10
Chaplin et al 1995 Blood 6136 4 Acute monoblastic leukemia without differentiation (FAB type M5a) t(10;11;21)(p12;q23;q22) MLL/MLLT10
Charest et al 2003 Genes Chromosomes Cancer 10027 1 Astrocytoma, grade III-IV Brain del(6)(q22q22) GOPC/ROS1
Charny et al 2000 J Pediatr Surg 8988 1 Ewing tumor/peripheral primitive neuroectodermal tumor Ureter t(11;22)(q24;q12) EWSR1/FLI1
Chase et al 1999 Blood 7908 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(12;13)(p13;q12) ETV6/CDX2
Chattopadhyay & Redner 2010 Cancer Genet Cytogenet 13297 1 Acute promyelocytic leukemia (FAB type M3) t(3;15;17)(p25;q22;q21) PML/RARA
Chen & Lee 2008 Hum Pathol 12659 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Liver t(2;2)(p23;q13) RANBP2/ALK
Chen et al 1988 Leukemia 2447 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;22)(q34;q11) BCR+
Chen et al 1988 Leukemia 2447 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(9;22)(q34;q11) BCR+
Chen et al 1988 Leukemia 2447 3 Acute myelomonocytic leukemia (FAB type M4) t(9;22)(q34;q11) BCR+
Chen et al 1989 Nucleic Acids Res 3238 1 Acute myelomonocytic leukemia (FAB type M4) t(9;22)(q34;q11) BCR/ABL1
Chen et al 1990 EMBO J 3357 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p33;q11) TRD@/TAL1
Chen et al 1991 Leukemia 3871 1 Acute promyelocytic leukemia (FAB type M3) der(17)(q21) RARA+
Chen et al 1991 Blood 4028 1 Acute promyelocytic leukemia (FAB type M3) t(11;17)(?;q21) RARA+
Chen et al 1992 Oncogene 4408 1 Acute promyelocytic leukemia (FAB type M3) t(11;17)(?;q21) RARA+
Chen et al 1993 EMBO J 4831 1 Acute promyelocytic leukemia (FAB type M3) t(11;17)(q23;q21) ZBTB16/RARA
Chen et al 1993 Cancer Genet Cytogenet 5104 1 Chronic myeloid leukemia, aberrant translocation t(X;9;22)(p11;q34;q11) BCR/ABL1
Chen et al 1993 Cancer Genet Cytogenet 5104 2 Chronic myeloid leukemia, aberrant translocation t(5;9;22)(p13;q34;q11) BCR/ABL1
Chen et al 1993 Cancer Genet Cytogenet 5104 3 Chronic myeloid leukemia, aberrant translocation t(9;14;22)(q34;q11;q11) BCR/ABL1
Chen et al 1998 Blood 7286 1 Diffuse large B-cell lymphoma t(3;22)(q27;q11) IGL@/BCL6
Chen et al 1998 Blood 7286 2 Diffuse large B-cell lymphoma t(3;8;14)(q27;q24;q32) IGH@/BCL6
Chen et al 1998 Blood 7286 3 Follicular lymphoma t(3;4)(q27;p14) RHOH/BCL6
Chen et al 1998 Oncogene 7890 1 Follicular lymphoma t(2;3)(q21;q27) BCL6+
Chen et al 1998 Oncogene 7890 2 Diffuse large B-cell lymphoma t(2;3)(q21;q27) BCL6+
Chen et al 2001 Genes Chromosomes Cancer 9229 1 Follicular lymphoma t(3;6)(q27;p21) SFRS3/BCL6
Chen et al 2001 Oncogene 9442 1 Follicular lymphoma t(1;14)(q21;q32) IGH@/FCGR2B
Chen et al 2003 Cancer Genet Cytogenet 9968 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;20)(p15;q12) NUP98/TOP1
Chen et al 2005 Leukemia 10968 1 Refractory anemia with excess of blasts (FAB) t(4;12)(q12;p13) CHIC2/ETV6
Chen et al 2005 Leukemia 10968 2 Acute myeloid leukemia, NOS t(1;2)(q21;q37) HHL+
Chen et al 2006 Blood 11685 1 Diffuse large B-cell lymphoma t(3;14)(q27;q32) HSP90AA1/BCL6
Chen et al 2006 Blood 11685 2 Diffuse large B-cell lymphoma t(3;3)(q29;q27) TFRC/BCL6
Chen et al 2006 Blood 11685 3 Diffuse large B-cell lymphoma t(3;12)(q27;p13) GAPDH/BCL6
Chen et al 2006 Blood 11685 4 Diffuse large B-cell lymphoma t(3;9)(q27;p24) DMRT1/BCL6
Chen et al 2007 Acta Haematol 12003 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(12;22)(p13;q12) MN1/ETV6
Cherif et al 1994 Leukemia 5458 2 Acute monoblastic leukemia (FAB type M5) t(6;11)(q27;q23) MLL+
Cherry et al 2001 Cancer Genet Cytogenet 9237 1 Acute myelomonocytic leukemia (FAB type M4) t(1;21)(p32;q22) RUNX1+
Chervinsky et al 1995 Genes Chromosomes Cancer 5555 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(14)(q11q32) IGH@/TRD@
Chesi et al 1997 Nat Genet 6934 1 Multiple myeloma t(4;14)(p16;q32) IGH@/FGFR3
Chesi et al 1998 Blood 7656 1 Multiple myeloma t(14;16)(q32;q23) IGH@/MAF
Chesi et al 1998 Blood 7656 2 Multiple myeloma t(16;22)(q23;q11) IGL@/MAF
Chesi et al 1998 Blood 7761 1 Multiple myeloma t(4;14)(p16;q32) IGH@/WHSC1
Cheung et al 2003 J Clin Endocrinol Metab 10053 1 Adenoma Thyroid t(2;3)(q13;p25) PAX8/PPARG
Chiecchio et al 2009 Genes Chromosomes Cancer 12829 1 Plasma cell leukemia dmin +MYC
Chiecchio et al 2009 Genes Chromosomes Cancer 12829 2 Plasma cell leukemia add(8)(q24) MYC+
Chiecchio et al 2009 Genes Chromosomes Cancer 12829 3 Plasma cell leukemia ins(8;14)(q24;q32q32) MYC+
Chikatsu et al 2003 Mod Pathol 11077 1 Diffuse large B-cell lymphoma t(2;17)(p23;q23) CLTC/ALK
Chinen et al 2008 Oncogene 12394 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;21)(q11;q22) RUNX1/AFF3
Chinwalla et al 2003 Oncogene 11110 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;15)(q23;q14-15) MLL/CASC5,MLL/ZFYVE19
Choi et al 2008 Cancer Res 12732 1 Adenocarcinoma Lung inv(2)(p21p23) EML4/ALK
Chou et al 1996 Cancer 6722 1 Anaplastic large cell lymphoma, systemic type t(2;5)(p23;q35) NPM1/ALK
Christiansen et al 1987 Cancer Genet Cytogenet 1894 1 Neuroblastoma Adrenal hsr +MYCN
Christiansen et al 2005 Cancer Genet Cytogenet 10992 1 Acute myeloid leukemia, NOS ins(10;11)(p12;q23q14) MLL/MLLT10
Chuang et al 2007 J Clin Pathol 12005 1 Extranodal marginal zone B-cell lymphoma Lung t(1;2)(p22;p11) IGK@/BCL10
Ciampi et al 2005 J Clin Invest 11160 1 Adenocarcinoma Thyroid inv(7)(q21q34) AKAP9/BRAF
Ciampi et al 2007 Endocr Relat Cancer 12196 1 Adenocarcinoma Thyroid t(8;10)(p11;q11) HOOK3/RET
Cianciulli et al 2004 Haematologica 11435 1 Chronic myeloid leukemia, aberrant translocation t(9;9;22)(p13;q34;q11) BCR/ABL1
Cigudosa et al 1995 Br J Haematol 6293 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(7;9;22)(p22;q34;q11) BCR/ABL1
Cimino et al 1991 Cancer Res 4167 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL+
Cimino et al 1991 Cancer Res 4167 2 Acute myeloid leukemia, NOS t(9;11)(p21;q23) MLL+
Cimino et al 1991 Cancer Res 4167 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL+
Cimino et al 1992 Cancer Res 4448 1 Bilineage or biphenotypic leukemia t(4;11)(q21;q23) MLL+
Cimino et al 1993 Blood 4932 1 Acute myeloid leukemia, NOS der(11)(q23) MLL+
Cimino et al 1993 Blood 4932 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Cimino et al 1997 Br J Haematol 6894 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Cirmena et al 2008 Cancer Genet Cytogenet 12470 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;22)(p24;q11) BCR/JAK2
Clappier et al 2006 Leukemia 11564 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;12)(q34;p13) TRB@/CCND2
Clappier et al 2006 Leukemia 11564 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;14)(p13;q11) CCND2+
Clappier et al 2007 Blood 12040 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;7)(q23;q34) TRB@/MYB
Clark et al 1994 Nat Genet 5481 1 Synovial sarcoma Soft tissue t(X;18)(p11;q11) SS18/SSX2
Clark et al 1996 Oncogene 6388 1 Chondrosarcoma, myxoid Soft tissue t(9;22)(q31;q12) EWSR1/NR4A3
Clark et al 1997 Oncogene 7416 1 Adenocarcinoma Kidney t(X;1)(p11;p34) SFPQ/TFE3
Clark et al 1997 Oncogene 7416 2 Adenocarcinoma Kidney inv(X)(p11q13) NONO/TFE3
Clark et al 2007 Oncogene 11830 1 Adenocarcinoma Prostate del(21)(q22q22),t(21;21)(q22;q22) TMPRSS2/ERG
Clark et al 2007 Oncogene 11830 2 Hyperplasia Prostate del(21)(q22q22),t(21;21)(q22;q22) TMPRSS2/ERG
Clark et al 2007 Oncogene 11830 3 Nonneoplastic epithelial disorder/lesion Prostate del(21)(q22q22),t(21;21)(q22;q22) TMPRSS2/ERG
Classen et al 2005 Ann Hematol 11313 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;17)(q23;q21) MLL+
Claxton et al 1994 Blood 5483 1 Acute myeloid leukemia, NOS inv(16)(p13q22) CBFB/MYH11
Claxton et al 1994 Blood 5483 3 Acute myeloid leukemia, NOS t(16;16)(p13;q22) CBFB/MYH11
Claxton et al 1994 Blood 5483 4 Chronic myeloid leukemia, t(9;22) inv(16)(p13q22) CBFB/MYH11
Cleary et al 1988 J Exp Med 2438 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;19)(q34;p13) TRB@+
Coenen et al 2011 Leuk Res 13445 1 Acute monoblastic leukemia (FAB type M5) t(3;11)(q13;q23) MLL/KIAA1524
Coignet et al 1999 Genes Chromosomes Cancer 8041 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;13)(p13;q14) ETV6+
Coignet et al 1999 Genes Chromosomes Cancer 8041 3 Chronic myeloid leukemia, t(9;22) t(12;13)(p13;q14) ETV6+
Coignet et al 1999 Genes Chromosomes Cancer 8041 4 Acute myeloblastic leukemia with maturation (FAB type M2) t(12;13)(p13;q12-13) ETV6+
Coignet et al 1999 Genes Chromosomes Cancer 8041 5 Acute monoblastic leukemia (FAB type M5) t(12;13)(p13;q12-13) ETV6+
Coindre et al 2004 J Pathol 10569 1 Fibrohistiocytic tumor, special type Soft tissue +der(?)t(?;4;6;12) +CDK4,+MDM2
Cokelaere et al 2002 Am J Surg Pathol 11503 1 Nonneoplastic lymphatic disorder/lesion t(6;12)(q23;q15) HMGA2+
Colecchia et al 2003 Arch Pathol Lab Med 10055 1 Ewing tumor/peripheral primitive neuroectodermal tumor Prostate t(11;22)(q24;q12) EWSR1/FLI1
Colleoni et al 2000 Am J Pathol 8551 1 Anaplastic large cell lymphoma, systemic type inv(2)(p23q35) ATIC/ALK
Company-Campins et al 2009 J Gastrointestin Liver Dis 13210 1 Synovial sarcoma Small intestine t(X;18)(p11;q11) SS18/SSX
Cook et al 2003 Hum Pathol 10460 1 Diffuse large B-cell lymphoma t(14;18)(q32;q21) IGH@/MALT1
Cools et al 1999 Blood 8363 1 Aggressive NK-cell leukemia t(4;12)(q12;p13) CHIC2/ETV6
Cools et al 1999 Blood 8363 2 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(4;12)(q12;p13) CHIC2/ETV6
Cools et al 2002 Genes Chromosomes Cancer 9631 1 Anaplastic large cell lymphoma, systemic type t(2;17)(p23;q23) CLTC/ALK
Cools et al 2002 Genes Chromosomes Cancer 9631 2 Anaplastic large cell lymphoma, systemic type t(2;17)(p23;q25) KIAA1618/ALK
Cools et al 2002 Genes Chromosomes Cancer 9631 3 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Soft tissue t(2;11;2)(p23;p15;q31) CARS/ALK
Cools et al 2002 Blood 12119 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(4;12)(q12;p13) CHIC2/ETV6
Cools et al 2002 Blood 12119 3 Atypical chronic myeloid leukemia t(5;12)(q31;p13) ETV6/ACSL6
Cools et al 2003 N Engl J Med 10092 1 Chronic eosinophilic leukemia/hypereosinophilic syndrome del(4)(q12q12) FIP1L1/PDGFRA
Corapcioglu et al 2003 J Pediatr Hematol Oncol 10391 1 Post-transplant lymphoproliferative disorder t(4;11)(q21;q23) MLL/AFF1
Corcoran et al 1999 Oncogene 8555 1 Splenic marginal zone B-cell lymphoma t(2;7)(p11;q21) IGK@/CDK6
Corcoran et al 1999 Oncogene 8555 2 Splenic marginal zone B-cell lymphoma t(7;21)(q21;q22) CDK6+
Corey et al 1994 Leukemia 5733 1 Acute promyelocytic leukemia (FAB type M3) t(5;17)(q32;q21) RARA+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 1 Acute myeloid leukemia, NOS t(11;19)(q23;p11) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 2 Acute myeloid leukemia, NOS t(1;11)(?;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 3 Acute myeloid leukemia, NOS t(6;11)(?;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 4 Acute myeloid leukemia, NOS t(10;11)(?;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 5 Acute myeloid leukemia, NOS t(11;22)(q23;?) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 6 Acute myeloid leukemia, NOS t(X;11)(q13;q23) MLL/FOXO4
Corral et al 1993 Proc Natl Acad Sci U S A 5126 7 Acute myeloid leukemia, NOS t(X;11)(?;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 8 Acute myeloid leukemia, NOS t(11;17)(q23;?) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 9 Acute myeloid leukemia, NOS t(9;11)(?;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 10 Acute myeloblastic leukemia with maturation (FAB type M2) t(4;11)(q21;q23) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 11 Acute monoblastic leukemia (FAB type M5) t(4;11)(q21;q23) MLL/AFF1
Corral et al 1993 Proc Natl Acad Sci U S A 5126 12 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL/MLLT1
Corral et al 1993 Proc Natl Acad Sci U S A 5126 13 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL/AFF1
Corral et al 1993 Proc Natl Acad Sci U S A 5126 14 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL/MLLT1
Corral et al 1993 Proc Natl Acad Sci U S A 5126 15 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p11) MLL+
Corral et al 1993 Proc Natl Acad Sci U S A 5126 18 Mature T- and NK-cell neoplasm, NOS t(11;19)(q23;p11) MLL+
Corveleyn et al 2005 Int J Oncol 11047 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(12;16)(p13;p13) SLAG+,MYH11+
Corvi et al 2000 Oncogene 8831 1 Adenocarcinoma Thyroid t(8;10)(p22;q11) PCM1/RET
Costa et al 2006 Cancer Genet Cytogenet 11422 1 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(q21;q34;q11) BCR/ABL1
Costa et al 2006 Cancer Genet Cytogenet 11422 2 Chronic myeloid leukemia, aberrant translocation t(5;9;22)(q31;q34;q11) BCR/ABL1
Costa et al 2006 Cancer Genet Cytogenet 11422 3 Chronic myeloid leukemia, aberrant translocation t(9;22;20;12)(q34;q11;q12;p13) BCR/ABL1
Costello et al 1997 Leukemia 7021 1 Acute monoblastic leukemia without differentiation (FAB type M5a) inv(16)(p13q22) CBFB/MYH11
Costello et al 1997 Leukemia 7021 2 Acute monoblastic leukemia with differentiation (FAB type M5b) inv(16)(p13q22) CBFB/MYH11
Costello et al 1997 Leukemia 7021 3 Acute megakaryoblastic leukemia (FAB type M7) t(16;16)(p13;q22) CBFB/MYH11
Coyaud et al 2010 Blood 13195 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q11;p13) PAX5/ELN
Coyaud et al 2010 Blood 13195 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;9)(p13;p13) PAX5/FOXP1
Coyaud et al 2010 Blood 13195 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(9)(p13p24) PAX5/JAK2
Coyaud et al 2010 Blood 13195 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q11;p12) PAX5/POM121
Coyaud et al 2010 Blood 13195 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(X;9)(q21;p13) PAX5/DACH2
Coyaud et al 2010 Blood 13195 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;17)(p13;p11-12) PAX5/NCOR1
Coyaud et al 2010 Blood 13195 7 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;15)(p13;q24) PAX5/GOLGA6A
Coyaud et al 2010 Blood 13195 8 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;17)(p13;q11) PAX5/TAOK1
Coyaud et al 2010 Leuk Res 13417 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q11;p13) PAX5/AUTS2
Crescenzi et al 2007 Cancer Genet Cytogenet 11991 1 Chronic myelomonocytic leukemia t(1;12;5;12)(p36;p13;q32;q24) ETV6/PDGFRB
Crew et al 1995 EMBO J 6041 1 Synovial sarcoma Soft tissue t(X;18)(p11;q11) SS18/SSX2
Crew et al 1995 EMBO J 6041 2 Synovial sarcoma Soft tissue t(X;18)(p11;q11) SS18/SSX1
Croce et al 1983 Proc Natl Acad Sci U S A 2068 1 Burkitt lymphoma/leukemia t(8;22)(q24;q11) IGL@/MYC
Crossen et al 1993 Genes Chromosomes Cancer 4941 1 Chronic lymphocytic leukemia t(14;19)(q32;q13) IGH@/BCL3
Crossen et al 1999 Cancer Genet Cytogenet 8119 1 Acute myeloblastic leukemia with maturation (FAB type M2) dmin +MYC,+PVT1
Crossen et al 1999 Cancer Genet Cytogenet 8195 1 Acute myeloblastic leukemia with maturation (FAB type M2) dmin +ETS1,+FLI1,+KCNJ5,+SRPR,+NFRKB,+IFNB1,+CDKN2A
Crowley et al 2005 Leukemia 11286 1 Acute myeloid leukemia, NOS t(8;16)(p11;p13) MYST3/CREBBP
Crozat et al 1993 Nature 4817 1 Liposarcoma, myxoid/round cell Soft tissue t(12;16)(q13;p11) FUS/DDIT3
Cuneo et al 2001 Haematologica 9165 1 Splenic marginal zone B-cell lymphoma add(3)(q27) BCL6+
Cuneo et al 2001 Haematologica 9165 2 Extranodal marginal zone B-cell lymphoma Stomach add(3)(q27) BCL6+
Cuneo et al 2001 Haematologica 9165 3 Extranodal marginal zone B-cell lymphoma Stomach t(3;14)(q27;q32) BCL6+
Cuneo et al 2001 Leukemia 9245 1 Splenic marginal zone B-cell lymphoma t(11;14)(p11;q32) IGH@+
Curtis et al 2007 Br J Haematol 12369 1 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(2;4)(p22;q12) STRN/PDGFRA
Curtis et al 2007 Br J Haematol 12369 2 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(4;12)(q12;p13) ETV6/PDGFRA
Cuthbert et al 1999 Genes Chromosomes Cancer 7880 1 Acute monoblastic leukemia without differentiation (FAB type M5a) trp(11)(q23) MLL+
Cuthbert et al 2000 Leukemia 9008 1 Acute monoblastic leukemia without differentiation (FAB type M5a) trp(11)(q23) +MLL+
Cuthbert et al 2000 Leukemia 9008 2 Acute myeloblastic leukemia without maturation (FAB type M1) dup(11)(q23q23) +MLL
Cuthbert et al 2000 Leukemia 9008 3 Acute myeloblastic leukemia with maturation (FAB type M2) hsr +MLL
Cuthbert et al 2000 Leukemia 9008 4 Acute myeloblastic leukemia without maturation (FAB type M1) dmin +MLL
Cuthbert et al 2000 Leukemia 9008 5 Acute myeloid leukemia, NOS der(11)t(6;11)(p2?5;q23)ins(11;?)(q23;?) +MLL+
Cuthbert et al 2000 Leukemia 9008 6 Acute myeloblastic leukemia without maturation (FAB type M1) der(11)?qdp(11)(q23q25)t(11;17)(q23;q12-21) +MLL
Cuthbert et al 2000 Leukemia 9008 7 Acute myeloblastic leukemia without maturation (FAB type M1) dmin +MLL+
Cuthbert et al 2000 Leukemia 9008 8 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) dmin +MLL
Cóser et al 2010 Cancer Genet Cytogenet 13216 1 Bilineage or biphenotypic leukemia t(10;11)(p12;q23) MLL/NEBL
Dahlen et al 2003 Mod Pathol 10380 1 Chondroma Soft tissue ins(4;12)(q3?4;q14q2?3) HMGA2+
Dahlen et al 2003 Mod Pathol 10380 2 Chondroma Soft tissue t(3;12)(q28;q14) HMGA2/LPP
Dahlen et al 2004 Am J Pathol 10573 1 Vascular and perivascular tumor, special type Soft tissue t(7;12)(p22;q13) ACTB/GLI1
Dahlen et al 2004 Am J Pathol 10573 2 Vascular and perivascular tumor, special type Tongue t(7;12)(p22;q13) ACTB/GLI1
Dahlen et al 2004 Am J Pathol 10573 3 Vascular and perivascular tumor, special type Stomach t(7;12)(p22;q13) ACTB/GLI1
Daheron et al 2001 Genes Chromosomes Cancer 9062 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(3;11)(q28;q23) MLL/LPP
Dai et al 2007 Cancer Genet Cytogenet 12100 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(1;21)(q12;q22) RUNX1+
Dai et al 2007 Cancer Genet Cytogenet 12100 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;21)(q13;q22) RUNX1+
Dai et al 2009 Genes Chromosomes Cancer 13013 1 Acute myeloid leukemia, NOS t(11;21)(q12;q22) RUNX1/LPXN
Dal Cin et al 1997 J Pathol 7056 1 Liposarcoma, myxoid/round cell Soft tissue t(12;22)(q13;q12) EWSR1/DDIT3
Dal Cin et al 1997 J Pathol 7056 2 Liposarcoma, myxoid/round cell Lung t(12;17;14;22)(q13;q23-24;q32;q12) EWSR1/DDIT3
Dal Cin et al 1997 Genes Chromosomes Cancer 7061 1 Mesenchymal tumor, special type Breast t(1;6)(p21;p21) HMGA1+
Dal Cin et al 1998 Cancer Res 7651 1 Adenoma Uterus, corpus der(6)(p21) HMGA1+
Dal Cin et al 1998 Cancer Res 7651 2 Adenoma Uterus, corpus der(12)(q14) HMGA2+
Dal Cin et al 2004 Cancer Genet Cytogenet 10488 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;17)(q23;q21) MLL+
Dalla-Favera et al 1982 Proc Natl Acad Sci U S A 2072 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) MYC+
Dalla-Favera et al 1983 Science 2155 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) IGH@/MYC
Dalla-Favera et al 1983 Science 2155 2 Burkitt lymphoma/leukemia t(2;8)(p12;q24) MYC+
Dalla-Favera et al 1983 Science 2155 3 Burkitt lymphoma/leukemia t(8;22)(q24;q11) MYC+
Dallery et al 1995 Oncogene 11125 1 Mature B-cell neoplasm, NOS t(3;4)(q27;p14) RHOH/BCL6
Dasgupta et al 1989 Oncogene 3229 1 Malignant melanoma Skin t(6;12)(q23;p12-13) MYB+
Daudignon et al 1999 Cancer Genet Cytogenet 8029 1 Diffuse large B-cell lymphoma t(3;4)(q27;p13) BCL6+
Dave et al 2002 Cancer Genet Cytogenet 9393 1 Diffuse large B-cell lymphoma del(14)(q32) IGH@+
Dave et al 2002 Cancer Genet Cytogenet 9393 2 Diffuse large B-cell lymphoma t(3;8)(q27;q24) BCL6+,MYC+
Dave et al 2002 Cancer Genet Cytogenet 9393 3 Diffuse large B-cell lymphoma t(3;4)(q27;q31) BCL6+
Dave et al 2002 Cancer Genet Cytogenet 9393 4 Diffuse large B-cell lymphoma t(14;15)(q32;q22) IGH@+
Dave et al 2002 Cancer Genet Cytogenet 9393 5 Diffuse large B-cell lymphoma dic(8;22)(q24;q11) MYC+
Dave et al 2005 Cancer Genet Cytogenet 11183 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;9)(q11;q34) ABL1+
Dave et al 2005 Cancer Genet Cytogenet 11183 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;9)(p?11;q34) ABL1+
Dave et al 2005 Cancer Genet Cytogenet 11183 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;9)(q37;q34) ABL1+
Davey et al 1988 Proc Natl Acad Sci U S A 2825 1 T-prolymphocytic leukemia t(14;14)(q11;q32) IGH@/TRA@
Davis et al 1994 Cancer Res 5450 1 Alveolar rhabdomyosarcoma Soft tissue t(1;13)(p36;q14) PAX7/FOXO1
Davis et al 2003 Proc Natl Acad Sci U S A 10134 1 Adenocarcinoma Kidney t(6;11)(p21;q13) MALAT1/TFEB
De Braekeleer et al 2007 Leukemia 12149 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;9)(q24;q34) ABL1+
De Braekeleer et al 2009 Ann Hematol 12880 1 Acute monoblastic leukemia (FAB type M5) t(1;19;11)(p36;p13;q23) MLL/ELL
De Braekeleer et al 2009 Blood Cells Mol Dis 12944 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(11;14)(q23;q32) MLL/KIAA0284
De Braekeleer et al 2009 Br J Haematol 13115 1 Acute myelomonocytic leukemia (FAB type M4) ins(11;X)(q23;q28q12) MLL/FLNA
De Braekeleer et al 2010 Blood Cells Mol Dis 13290 1 Acute monoblastic leukemia (FAB type M5) ins(X;11)(q24;q23q23) MLL/SEPT6
De Braekeleer et al 2010 Blood Cells Mol Dis 13290 2 Acute monoblastic leukemia (FAB type M5) t(1;11;10)(p32;q23;q24) MLL/EPS15
De Cecco et al 2005 Histopathology 10808 1 Liposarcoma, pleomorphic Intraabdominal t(12;16)(q13;p11) FUS/DDIT3
De Keersmaecker et al 2005 Blood 11014 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;14)(q34;q32) EML1/ABL1
De Paepe et al 2003 Blood 10373 1 Diffuse large B-cell lymphoma t(2;17)(p23;q23) CLTC/ALK
De Schouwer et al 2000 Br J Haematol 8941 1 T-prolymphocytic leukemia t(X;7)(q28;q34) TRB@/MTCP1
Debelenko et al 2003 Lab Invest 10344 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Soft tissue t(2;11)(p23;p15) CARS/ALK
Debiec-Rychter et al 2003 Genes Chromosomes Cancer 10127 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Bladder inv(2)(p23q35) ATIC/ALK
Debiec-Rychter et al 2003 Am J Pathol 10272 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Liver t(2;3)(p23;q29) ALK+
Delattre et al 1992 Nature 4412 1 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Demiroglu et al 2001 Blood 9738 1 Chronic myeloproliferative disorder, NOS t(8;22)(p11;q11) BCR/FGFR1
Denny et al 1986 Science 1657 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(14)(q11q32) IGH@/TRA@
Denny et al 1986 Nature 2086 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma inv(14)(q11q32) IGH@/TRA@
Desmaze et al 1997 Cancer Genet Cytogenet 7045 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(2;11;22)(p14;q24;q12) EWSR1/FLI1
Dessars et al 2007 J Invest Dermatol 11948 1 Melanocytic neoplasm, special type t(5;7)(q31;q34) FCHSD1/BRAF
Deveney et al 2003 Genes Chromosomes Cancer 10107 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(5;11)(q31;q23q23) MLL/AFF4
Dewald et al 1993 Cancer Genet Cytogenet 5137 1 Chronic myeloid leukemia, aberrant translocation t(9;22;19)(q34;q11;q13) BCR/ABL1
Dewald et al 1993 Cancer Genet Cytogenet 5137 2 Chronic myeloid leukemia, aberrant translocation t(9;22;12)(q34;q11;q15) BCR/ABL1
Dhingra et al 1991 Leukemia 3817 1 Chronic myeloid leukemia, aberrant translocation t(9;22;11)(q34;q11;p?) BCR/ABL1
Dierlamm et al 1997 Genes Chromosomes Cancer 7099 1 Follicular lymphoma t(1;3)(p32;q27) BCL6+
Dierlamm et al 1997 Br J Haematol 7402 1 Nodal marginal zone B-cell lymphoma t(3;14)(q27;q32) BCL6+
Dierlamm et al 1999 Blood 8078 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;18)(q22;q21) BIRC3/MALT1
Dierlamm et al 1999 Cancer Genet Cytogenet 8262 1 Chronic myeloid leukemia, aberrant translocation t(Y;9;22)(q12;q34;q11) BCR/ABL1
Dierlamm et al 2000 Blood 8773 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;18)(q22;q21) BIRC3/MALT1
Dierlamm et al 2000 Blood 8773 2 Extranodal marginal zone B-cell lymphoma Small intestine t(11;18)(q22;q21) BIRC3/MALT1
Dierlamm et al 2002 Leukemia 9803 1 Extranodal marginal zone B-cell lymphoma Lung t(11;12;18)(q22;q13;q21) BIRC3/MALT1
Diffin et al 1994 J Clin Pathol 5673 1 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(11;22)(q24;q12) EWSR1/FLI1
Diffin et al 1994 J Clin Pathol 5673 2 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(11;22)(q24;q12) EWSR1/FLI1
Djabali et al 1992 Nat Genet 4512 2 Acute myeloid leukemia, NOS t(9;11)(p21;q23) MLL+
Dolan et al 2002 Cancer Genet Cytogenet 9523 1 Acute monoblastic leukemia without differentiation (FAB type M5a) hsr +MLL
Dolan et al 2002 Cancer Genet Cytogenet 9523 2 Acute myeloid leukemia, NOS hsr +MLL
Domer et al 1993 Proc Natl Acad Sci U S A 4986 1 Bilineage or biphenotypic leukemia t(4;11)(q21;q23) MLL/AFF1
Domer et al 1995 Leukemia 6109 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(9;11)(p21;q23) MLL+
Domer et al 1995 Leukemia 6109 2 Acute myeloblastic leukemia with maturation (FAB type M2) add(11)(q23) MLL+
Domer et al 1995 Leukemia 6109 3 Acute myelomonocytic leukemia (FAB type M4) inv(11)(p15q23) MLL+
Domer et al 1995 Leukemia 6109 4 Acute monoblastic leukemia (FAB type M5) t(11;21)(q23;q22) MLL+
Donti et al 1988 Leukemia 2243 1 Follicular lymphoma t(2;8)(p11;q24) IGK@+
Douet-Guilbert et al 2005 Cancer Genet Cytogenet 10881 1 Acute monoblastic leukemia (FAB type M5) ins(X;11)(q24-25;q23q23) MLL+
Douet-Guilbert et al 2005 Cancer Genet Cytogenet 10883 1 Acute myelomonocytic leukemia (FAB type M4) t(1;11)(p32;q23) MLL+
Douet-Guilbert et al 2005 Leuk Lymphoma 10979 1 Acute monoblastic leukemia (FAB type M5) t(1;11)(p36;q23) MLL+
Douet-Guilbert et al 2005 Cancer Genet Cytogenet 11223 1 Acute promyelocytic leukemia (FAB type M3) t(11;17;15)(q13;q21;q22) PML/RARA
Dow et al 1991 Cancer 3963 1 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(q25;q34;q11) BCR/ABL1
Dow et al 1991 Cancer 3963 2 Chronic myeloid leukemia, aberrant translocation t(9;12;22)(q34;p11;q11) BCR/ABL1
Downing et al 1993 Blood 4922 1 Acute myeloid leukemia, NOS t(8;21)(q22;q22) RUNX1/RUNX1T1
Downing et al 1993 Blood 4922 2 Acute myeloid leukemia, NOS t(8;13;21)(q22;q12;q22) RUNX1/RUNX1T1
Downing et al 1993 Am J Pathol 5262 1 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Downing et al 1995 Blood 6047 2 Diffuse large B-cell lymphoma t(2;5)(p23;q35) NPM1/ALK
Downing et al 1995 Blood 6047 3 Mature B-cell neoplasm, NOS t(2;5)(p23;q35) NPM1/ALK
Dragon-Durey et al 1998 Leukemia 7551 1 Acute myeloid leukemia, NOS t(3;5)(q25;q35) NPM1+
Dreazen et al 1987 Br J Haematol 2359 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(22)(q11) BCR+
Dreazen et al 1987 Br J Haematol 2359 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR/ABL1
Drechsler et al 2007 Ann Hematol 11968 1 Chronic myelomonocytic leukemia t(5;10)(q32;q21) CCDC6/PDGFRB
Dreyling et al 1998 Blood 7556 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(10;11)(p12;q23) MLL/MLLT10
Dreyling et al 1998 Blood 7556 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(10;11)(p12-13;q23) MLL+
Dreyling et al 1998 Blood 7556 3 Acute myeloblastic leukemia with maturation (FAB type M2) inv(11)(q13q23) MLL+
Dreyling et al 1998 Blood 7556 4 Acute myeloblastic leukemia without maturation (FAB type M1) t(10;11)(p12;q14) PICALM/MLLT10
Dreyling et al 1998 Blood 7556 5 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(10;11)(p12;q14) PICALM/MLLT10
Dreyling et al 1998 Blood 7556 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(p12;q14) PICALM+
Dube et al 1989 Genes Chromosomes Cancer 3056 1 Chronic myeloid leukemia, aberrant translocation t(9;22;16)(q34;q11;q24) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 2 Chronic myeloid leukemia, aberrant translocation t(7;9;22)(q31;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 3 Chronic myeloid leukemia, aberrant translocation t(2;9;22;7)(q31;q34;q11;q34) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 4 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p22;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 5 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(p21;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 6 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p36;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 7 Chronic myeloid leukemia, aberrant translocation t(9;22;20)(q34;q11;q13) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 8 Chronic myeloid leukemia, aberrant translocation t(9;22;10)(q34;q11;p13) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 9 Chronic myeloid leukemia, aberrant translocation t(2;9;22)(q37;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 10 Chronic myeloid leukemia, aberrant translocation t(9;22;14)(q34;q11;q13) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 11 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q21;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 12 Chronic myeloid leukemia, aberrant translocation t(9;22;10;17)(q34;q11;p13;q21) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 13 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(?;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 14 Chronic myeloid leukemia, aberrant translocation t(5;9;22)(q13;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 15 Chronic myeloid leukemia, aberrant translocation t(7;22)(q22;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 16 Chronic myeloid leukemia, aberrant translocation t(19;22)(q13;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 17 Chronic myeloid leukemia, aberrant translocation t(9;9;22)(p12;q34;q11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 18 Chronic myeloid leukemia, aberrant translocation t(3;22;9)(q21;q11;q34) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 19 Chronic myeloid leukemia, aberrant translocation t(9;22;13)(q34;q11;p11) BCR+
Dube et al 1989 Genes Chromosomes Cancer 3056 20 Chronic myeloid leukemia, aberrant translocation t(9;22;12)(q34;q11;q24) BCR+
Dube et al 2003 Cancer Genet Cytogenet 10216 1 Acute monoblastic leukemia (FAB type M5) t(11;17)(q23;q21) MLL+
Dunham et al 2008 Am J Surg Pathol 12428 1 Angiomatoid malignant fibrous histiocytoma Brain t(12;22)(q13;q12) EWSR1/ATF1
Dunn et al 1994 Cancer Genet Cytogenet 11167 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(21;22)(q22;q12) EWSR1/ERG
Dunn et al 1994 Cancer Genet Cytogenet 11167 2 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(11;22)(q24;q12) EWSR1/FLI1
Duro et al 1995 Oncogene 6120 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;14)(p21;q11) TRA@/CDKN2A
Duro et al 1996 Cancer Res 6240 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;14)(p21;q11) TRD@+
Dyer et al 1994 Blood 5525 1 Chronic lymphocytic leukemia t(2;18)(p11;q21) IGK@/BCL2
Dyomin et al 1997 Proc Natl Acad Sci U S A 7016 1 Diffuse large B-cell lymphoma t(14;15)(q32;q11-13) IGH@/BCL8
Dyomin et al 2000 Blood 8622 1 Mature B-cell neoplasm, NOS t(1;14)(q22;q32) IGH@/MUC1
Eclache et al 2005 Cancer Genet Cytogenet 10867 1 Acute promyelocytic leukemia (FAB type M3) t(6;15;17)(q25;q22;q21) PML/RARA
Eguchi et al 1999 Blood 7904 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(12;15)(p13;q25) ETV6/NTRK3
Eguchi et al 2001 Genes Chromosomes Cancer 9253 1 Acute undifferentiated leukemia t(11;14)(q23;q23) MLL/GPHN
Eguchi-Ishimae et al 2001 Blood 8800 1 Nonneoplastic lymphatic disorder/lesion t(12;21)(p13;q22) ETV6/RUNX1
Elisei et al 2001 J Clin Endocrinol Metab 9248 1 Adenoma Thyroid inv(10)(q11q21) CCDC6/RET
Elisei et al 2001 J Clin Endocrinol Metab 9248 2 Adenoma Thyroid inv(10)(q11q11) NCOA4/RET
Elisei et al 2005 Thyroid 11360 1 Germ cell tumor, special type Ovary inv(10)(q11q11) NCOA4/RET
Ellisen et al 1991 Cell 4007 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q34;q34) TRB@/NOTCH1
Emanuel et al 1984 Proc Natl Acad Sci U S A 2075 1 Burkitt lymphoma/leukemia t(2;8)(p11;q24) IGK@/MYC
Endo et al 1995 Cancer Genet Cytogenet 5938 1 Chronic myeloid leukemia, aberrant translocation t(2;9;14;22)(p21;q34;q32;q11) BCR+
Erben et al 2010 Haematologica 13398 1 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(4;22)(q12;q11) BCR/PDGFRA
Erben et al 2010 Haematologica 13398 2 Chronic eosinophilic leukemia/hypereosinophilic syndrome ins(9;4)(q33;q12q25) CDK5RAP2/PDGFRA
Erben et al 2010 Haematologica 13398 3 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(4;12)(q12;p13) ETV6/PDGFRA
Erben et al 2010 Haematologica 13398 4 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(4;10)(q12;p11) KIF5B/PDGFRA
Erben et al 2010 Haematologica 13398 5 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(5;10)(q32;q21) CCDC6/PDGFRB
Erben et al 2010 Haematologica 13398 6 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(5;12)(q32;p13) ETV6/PDGFRB
Erben et al 2010 Haematologica 13398 7 Chronic eosinophilic leukemia/hypereosinophilic syndrome ins(11;5)(p13;q15q32) CAPRIN1/PDGFRB
Erben et al 2010 Haematologica 13398 8 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(5;12)(q32;q24) GIT2/PDGFRB
Erben et al 2010 Haematologica 13398 9 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(5;17)(q32;q11) MYO18A/PDGFRB
Erben et al 2010 Haematologica 13398 10 Chronic eosinophilic leukemia/hypereosinophilic syndrome t(5;12)(q32;q23) SART3/PDGFRB
Erben et al 2010 Haematologica 13398 11 Myelodysplastic/myeloproliferative disease, NOS t(5;12)(q31;p13) ETV6/ACSL6
Erben et al 2010 Haematologica 13398 12 Chronic myeloproliferative disorder, NOS t(3;5)(q25;q35) NPM1/MLF1
Erickson et al 1992 Blood 4509 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;21)(q22;q22) RUNX1/RUNX1T1
Eridani et al 1987 Leuk Res 2381 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR/ABL1
Erikson et al 1983 Proc Natl Acad Sci U S A 2073 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) IGH@/MYC
Erikson et al 1983 Proc Natl Acad Sci U S A 4507 1 Burkitt lymphoma/leukemia t(2;8)(p11;q24) IGK@/MYC
Erikson et al 1984 Proc Natl Acad Sci U S A 1118 1 Chronic lymphocytic leukemia t(11;14)(q13;q32) IGH@+
Erikson et al 1985 Science 1203 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRA@+
Erikson et al 1986 Proc Natl Acad Sci U S A 1575 1 Acute myeloid leukemia, NOS t(9;22)(q34;q11) BCR+
Erikson et al 1986 Proc Natl Acad Sci U S A 1575 2 Acute undifferentiated leukemia t(9;22)(q34;q11) BCR+
Erikson et al 1986 Proc Natl Acad Sci U S A 1575 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR+
Erikson et al 1986 Science 2085 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRA@/MYC
Erikson et al 1986 Science 2085 2 T-prolymphocytic leukemia t(8;14)(q24;q11) TRA@/MYC
Esgueva et al 2010 Mod Pathol 13240 1 Adenocarcinoma Prostate t(8;21)(q24;q22) NDRG1/ERG
Espinoza et al 2005 Cancer Genet Cytogenet 10882 1 Chronic myeloid leukemia, aberrant translocation t(9;22;16)(q34;q11;p13) BCR/ABL1
Esteyries et al 2008 Leukemia 12351 1 Acute monoblastic leukemia (FAB type M5) t(8;20)(p11;q13) MYST3/NCOA3
Etienne et al 2007 Cancer Genet Cytogenet 11820 1 Bilineage or biphenotypic leukemia t(8;13)(p11;q12) ZMYM2/FGFR1
Etienne et al 2007 Cancer Genet Cytogenet 11820 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;13)(p11;q12) ZMYM2/FGFR1
Evans et al 1997 Leukemia 6983 1 Acute myeloblastic leukemia with maturation (FAB type M2) inv(16)(p13q22) CBFB/MYH11
Evans et al 1997 Leukemia 6983 2 Myelodysplastic syndrome, NOS inv(16)(p13q22) CBFB/MYH11
Fabris et al 2003 Genes Chromosomes Cancer 10618 1 Multiple myeloma t(8;14)(q24;q32) IGH@/MYC
Fabris et al 2003 Genes Chromosomes Cancer 10618 2 Plasma cell leukemia t(8;14)(q24;q32) IGH@/MYC
Fabris et al 2005 Genes Chromosomes Cancer 11112 1 Plasma cell leukemia t(6;14)(p21;q32) IGH@/CCND3
Farra et al 2004 Cancer Genet Cytogenet 10835 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;12;21)(q22;p12-13;q22) RUNX1/RUNX1T1
Fehr et al 2008 Genes Chromosomes Cancer 12248 1 Mucoepidermoid carcinoma Salivary gland t(11;15)(q21;q26) CRTC3/MAML2
Feldman et al 2009 Leukemia 12773 1 Peripheral T-cell lymphoma, unspecified t(6;14)(p25;q11) TRA@/IRF4
Felix et al 1995 Blood 5978 2 Acute myelomonocytic leukemia (FAB type M4) t(3;11)(q25;q23) MLL+
Felix et al 1995 Blood 5978 3 Acute megakaryoblastic leukemia (FAB type M7) der(11)(q23) MLL+
Felix et al 1995 Blood 5978 4 Refractory anemia t(1;11)(p32;q23) MLL+
Felix et al 1995 Blood 5978 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(11)(q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 1 Acute myeloid leukemia, NOS t(10;11)(q11;q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(X;11)(q22;q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 3 Acute monoblastic leukemia (FAB type M5) ins(10;11)(p11;q13q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(11)(q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 5 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12-15;q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 6 Acute monoblastic leukemia (FAB type M5) t(9;11)(p21;q23) MLL+
Felix et al 1998 J Pediatr Hematol Oncol 7832 7 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Felix et al 1998 Proc Natl Acad Sci U S A 7876 1 Acute myeloid leukemia, NOS t(11;17)(q23;q25) MLL+
Felix et al 1998 Proc Natl Acad Sci U S A 7876 2 Acute myelomonocytic leukemia (FAB type M4) del(11)(q23) MLL+
Felix et al 1998 Proc Natl Acad Sci U S A 7876 3 Myelodysplastic syndrome, NOS t(11;19)(q23;p13) MLL+
Fell et al 1986 Science 1572 1 Chronic lymphocytic leukemia t(2;14)(p13;q32) IGH@+
Fenton et al 2006 Genes Chromosomes Cancer 11115 1 Diffuse large B-cell lymphoma t(3;14)(p13;q32) IGH@/FOXP1
Fiedler et al 1991 Ann Hematol 4139 2 Burkitt lymphoma/leukemia t(14;18)(q32;q21) IGH@/BCL2
Finelli et al 1999 Blood 8122 2 Plasma cell leukemia t(4;14)(p16;q32) IGH@/FGFR3,IGH@/WHSC1
Finger et al 1986 Science 1947 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRA@/MYC
Finger et al 1988 Proc Natl Acad Sci U S A 2958 1 Mycosis fungoides/Sezary syndrome t(2;8)(q34;q24) MYC+
Finger et al 1989 Proc Natl Acad Sci U S A 3034 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p33;q11) TRD@/TAL1
Finger et al 1989 Proc Natl Acad Sci U S A 3034 2 Malignant melanoma Unknown site del(1)(p33) TAL1+
Finke et al 1994 Ann Hematol 5461 1 Acute undifferentiated leukemia t(11;19)(q23;p13) MLL+
Finke et al 1994 Ann Hematol 5461 2 Acute myeloid leukemia, NOS t(2;11)(p21;q23) MLL+
Finke et al 2002 Am J Surg Pathol 9632 1 Desmoplastic small round cell tumor Nasal cavity/Paranasal sinuses t(11;22)(p13;q12) EWSR1/WT1
Finver et al 1989 Oncogene Res 3317 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRD@+
Fioretos et al 2001 Genes Chromosomes Cancer 9312 1 Chronic myeloproliferative disorder, NOS t(8;22)(p11;q11) BCR/FGFR1
Fisch et al 1992 Eur J Immunol 4636 1 Mature T- and NK-cell neoplasm, NOS inv(14)(q11q32) IGH@/TRA@
Fitzgerald et al 1991 Blood 4027 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;7)(p33;q34) TRB@/TAL1
Fitzgerald et al 1992 Blood 4622 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;11)(q34;p13) TRB@/LMO2
Fizzotti et al 1994 Leukemia 5702 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR/ABL1
Fleischman et al 1999 Genes Chromosomes Cancer 7815 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(2;11)(p21;q23) MLL+
Fong et al 2008 Hum Pathol 12587 1 Ewing tumor/peripheral primitive neuroectodermal tumor Vagina t(11;22)(q24;q12) EWSR1/FLI1
Fonseca et al 2001 Blood 9152 1 Monoclonal gammopathy of undetermined significance t(4;14)(p16;q32) IGH@/FGFR3
Ford et al 1993 Nature 4867 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Forshew et al 2009 J Pathol 12776 1 Astrocytoma, pilocytic/juvenile Brain dup(7)(q34q34) KIAA1549/BRAF
Forshew et al 2009 J Pathol 12776 2 Astrocytoma, pilocytic/juvenile Brain dup(3)(p25p25) SRGAP3/RAF1
Forster & Rabbitts 1993 Oncogene 5156 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL/AFF1
Foster et al 2010 Br J Haematol 13373 1 Refractory anemia with excess blasts-2 t(7;21)(p22;q22) RUNX1/USP42
Foster et al 2010 Br J Haematol 13373 2 Acute monoblastic leukemia (FAB type M5) t(7;21)(p22;q22) RUNX1/USP42
Francois et al 1998 Genes Chromosomes Cancer 7587 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;5)(p33;q31) TAL1+
Franke et al 2001 Blood 8952 1 Hodgkin disease, lymphocyte predominance t(3;22)(q27;q12) BCL6+
Frascella et al 2000 Cancer Genet Cytogenet 8742 2 Alveolar rhabdomyosarcoma Soft tissue dmin +MYCN
Frater et al 2007 Cancer Genet Cytogenet 11906 1 Lymphoplasmacytic lymphoma inv(16)(p13q22) CBFB+
Freeman et al 2004 Mod Pathol 11078 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Bladder der(2)(p23) ALK+
Freeman et al 2009 Beijing Da Xue Xue Bao 13450 1 Acute promyelocytic leukemia (FAB type M3) t(3;17;15)(q27;q21;q22) PML/RARA
Freeman et al 2009 Beijing Da Xue Xue Bao 13450 2 Acute promyelocytic leukemia (FAB type M3) t(8;17;15)(q24;q21;q22) PML/RARA
French et al 2001 Am J Pathol 9455 1 Undifferentiated carcinoma Intrathoracal t(15;19)(q13;p13) BRD4+
French et al 2003 Cancer Res 9832 1 Undifferentiated carcinoma Intrathoracal t(15;19)(q14;p13) BRD4/C15ORF55
French et al 2004 J Clin Oncol 11083 1 Undifferentiated carcinoma Thymus t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 2 Undifferentiated carcinoma Larynx t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 3 Squamous cell carcinoma Nasopharynx t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 4 Squamous cell carcinoma Intrathoracal t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 5 Squamous cell carcinoma Bladder t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 6 Squamous cell carcinoma Eye t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 7 Undifferentiated carcinoma Nasal cavity/Paranasal sinuses t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 8 Undifferentiated carcinoma Intrathoracal t(15;19)(q14;p13) BRD4/C15orf55
French et al 2004 J Clin Oncol 11083 9 Squamous cell carcinoma Lung der(15)(q14) C15orf55+
French et al 2004 J Clin Oncol 11083 10 Undifferentiated carcinoma Intrathoracal der(15)(q14) C15orf55+
French et al 2004 J Clin Oncol 11083 11 Undifferentiated carcinoma Nasopharynx der(15)(q14) C15orf55+
French et al 2008 Oncogene 12425 1 Squamous cell carcinoma t(9;15)(q34;q14) BRD3/C15orf55
French et al 2008 Oncogene 12425 2 Undifferentiated carcinoma t(9;15)(q34;q14) BRD3/C15orf55
Friedrichs et al 2005 Int J Surg Pathol 11296 1 Clear cell sarcoma Small intestine t(12;22)(q13;q12) EWSR1/ATF1
Fu et al 2003 Genes Chromosomes Cancer 10020 1 Acute myeloblastic leukemia without maturation (FAB type M1) del(11)(q23q23) MLL/CBL
Fu et al 2003 Genes Chromosomes Cancer 10301 1 Acute myelomonocytic leukemia (FAB type M4) t(X;11)(q24;q23) MLL/SEPT6
Fu et al 2005 Genes Chromosomes Cancer 10899 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;20)(q23;q11) MLL/MAPRE1
Fu et al 2007 Am J Clin Pathol 11765 1 Acute megakaryoblastic leukemia (FAB type M7) t(11;19)(q23;p13) MLL/MLLT1
Fu et al 2007 Am J Clin Pathol 11765 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;19)(q23;p13) MLL/MLLT1
Fu et al 2007 Am J Clin Pathol 11765 3 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(11;19)(q23;p13) MLL/MLLT1
Fuchs et al 2001 Proc Natl Acad Sci U S A 9286 1 Acute myelomonocytic leukemia (FAB type M4) ins(11;9)(q23;q34q34) MLL/FNBP1
Fujino et al 2002 Blood 9742 1 Chronic myeloid leukemia, t(9;22) t(7;11)(p15;p15) NUP98/HOXA11
Fujino et al 2002 Blood 9742 2 Myelodysplastic syndrome, NOS t(7;11)(p15;p15) NUP98/HOXA9,NUP98/HOXA13
Fujisawa et al 2002 Int J Hematol 10208 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;9;22)(q32;q34;q11) BCR/ABL1
Fujishima et al 2000 Cancer Genet Cytogenet 8611 1 Acute promyelocytic leukemia (FAB type M3) t(2;15;17)(q21;q22;q21) PML/RARA
Fujita et al 2003 Leuk Lymphoma 10329 1 Acute promyelocytic leukemia (FAB type M3) ins(17;15)(q21;q22q22) PML/RARA
Fukuda et al 2000 Pathol Int 8826 1 Clear cell sarcoma Large intestine t(12;22)(q13;q12) EWSR1/ATF1
Fukuda et al 2002 Int J Hematol 9645 1 Refractory anemia with excess blasts-1 der(11)(q23) MLL+
Galiegue-Zouitina et al 1996 Leukemia 6604 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;11)(q27;q23) POU2AF1/BCL6
Galiegue-Zouitina et al 1999 Genes Chromosomes Cancer 8133 1 Follicular lymphoma t(3;13)(q27;q14) LCP1/BCL6
Galiegue-Zouitina et al 1999 Genes Chromosomes Cancer 8133 2 Diffuse large B-cell lymphoma t(3;13)(q27;q14) LCP1/BCL6
Galieni et al 1996 Leukemia 6697 1 Acute promyelocytic leukemia (FAB type M3) t(1;15;17)(q23;q22;q21) PML/RARA
Galili et al 1993 Nat Genet 4894 1 Alveolar rhabdomyosarcoma Soft tissue t(2;13)(q36;q14) PAX3/FOXO1
Galiègue-Zouitina et al 1995 C R Acad Sci III 11124 1 Mature B-cell neoplasm, NOS t(3;11)(q27;q23) POU2AF1/BCL6
Gallagher et al 2008 Cancer Genet Cytogenet 12329 1 Mastocytosis t(4;5)(q21;q32) PRKG2/PDGFRB
Gallagher et al 2008 Cancer Genet Cytogenet 12329 2 Chronic myeloproliferative disorder, NOS t(2;5)(p16;q32) SPTBN1/PDGFRB
Gallego et al 1994 Cancer Genet Cytogenet 5508 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;13;21)(q22;q12;q22) RUNX1/RUNX1T1
Gallego et al 1996 Cancer Genet Cytogenet 6307 1 Chronic myeloid leukemia, aberrant translocation t(Y;22)(p11;q11) BCR+
Gamerdinger et al 2003 Genes Chromosomes Cancer 9972 1 Acute myeloblastic leukemia with maturation (FAB type M2) ins(21;8)(q22;q22q22) RUNX1/RUNX1T1
Gamerdinger et al 2003 Genes Chromosomes Cancer 9972 2 Acute myeloblastic leukemia with maturation (FAB type M2) ins(8;21)(q22;q22q22) RUNX1/RUNX1T1
Gamerdinger et al 2003 Genes Chromosomes Cancer 9972 3 Acute myeloblastic leukemia without maturation (FAB type M1) ins(21;8)(q22;q22q22) RUNX1/RUNX1T1
Gamerdinger et al 2003 Genes Chromosomes Cancer 9972 4 Acute myeloblastic leukemia without maturation (FAB type M1) ins(21;8)(q22;q21q22) RUNX1/RUNX1T1
Gamerdinger et al 2003 Genes Chromosomes Cancer 9972 5 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;12;21)(q22;p13;q22) RUNX1/RUNX1T1
Gamou et al 1998 Blood 7519 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(16;21)(q24;q22) RUNX1/CBFA2T3
Gamou et al 1998 Blood 7519 2 Myelodysplastic syndrome, NOS t(16;21)(q24;q22) RUNX1/CBFA2T3
Ganesan et al 1986 Blood 1685 1 Chronic myeloid leukemia, aberrant translocation del(22)(q11) BCR+
Ganesan et al 1986 Blood 1685 3 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(p11;q34;q11) BCR+
Gascoyne et al 2003 Blood 10372 1 Diffuse large B-cell lymphoma t(2;17;7)(p23;q23;q22) CLTC/ALK
Gascoyne et al 2003 Blood 10372 2 Diffuse large B-cell lymphoma t(2;17)(p23;q23) CLTC/ALK
Gauwerky et al 1988 Oncogene 2483 1 Follicular lymphoma t(8;14)(q24;q32) IGH@/MYC
Gauwerky et al 1988 Proc Natl Acad Sci U S A 2786 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q32) IGH@/MYC
Gauwerky et al 1989 Proc Natl Acad Sci U S A 3228 1 B-prolymphocytic leukemia t(8;19)(q24;q13) BCL3/MYC
Gauwerky et al 1989 Proc Natl Acad Sci U S A 3228 2 B-prolymphocytic leukemia t(14;18)(q32;q21) IGH@/BCL2
Gelsi-Boyer et al 2008 BMC Cancer 12835 1 Chronic myelomonocytic leukemia del(21)(q21q22) USP16/RUNX1
Gerald et al 1995 Proc Natl Acad Sci U S A 5886 1 Desmoplastic small round cell tumor Unknown site t(11;22)(p13;q12) EWSR1/WT1
Gervais et al 2005 Leukemia 11146 1 Acute myelomonocytic leukemia (FAB type M4) t(9;11)(q34;p15) NUP98/PRRX2
Gesk et al 2006 Blood 11610 1 Mantle cell lymphoma t(2;12)(p11;p13) IGK@/CCND2
Geurts et al 1997 Cancer Res 6774 1 Adenoma Salivary gland ins(3;12)(p14;q14q14) HMGA2/FHIT
Geurts et al 1998 Oncogene 10420 1 Adenoma Salivary gland ins(9;12)(p22;q14q14) HMGA2/NFIB
Geurts et al 1998 Oncogene 10420 2 Adenoma Salivary gland ins(9;12)(p22;q12q14) HMGA2/NFIB
Giguère & Hebert 2010 Cancer Genet Cytogenet 13365 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(1;21)(p22;q22) RUNX1/CLCA2
Giles et al 1997 Leukemia 7280 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(8;16)(p11;p13) CREBBP+
Giles et al 1997 Leukemia 7280 2 Acute monoblastic leukemia (FAB type M5) t(8;16)(p11;p13) CREBBP+
Giles et al 1997 Leukemia 7280 3 Acute myelomonocytic leukemia (FAB type M4) t(8;16)(p11;p13) CREBBP+
Giles et al 1997 Leukemia 7280 4 Acute monoblastic leukemia without differentiation (FAB type M5a) t(8;16)(p11;p13) MYST3+,CREBBP+
Giles et al 1997 Leukemia 7280 5 Acute myelomonocytic leukemia (FAB type M4) t(8;16)(p11;p13) MYST3+
Giles et al 1997 Leukemia 7280 6 Acute monoblastic leukemia (FAB type M5) t(8;16)(p11;p13) MYST3+
Giles et al 1997 Leukemia 7280 7 Acute monoblastic leukemia with differentiation (FAB type M5b) t(8;16)(p11;p13) CREBBP+
Gill Super et al 1993 Blood 5189 1 Acute myeloid leukemia, NOS t(9;11;18)(p22;q23;q12) MLL+
Gill Super et al 1993 Blood 5189 2 Acute myeloid leukemia, NOS t(11;19)(q23;p13) MLL+
Gill Super et al 1993 Blood 5189 3 Acute myelomonocytic leukemia (FAB type M4) t(9;11)(p21;q23) MLL+
Gill Super et al 1993 Blood 5189 4 Acute myelomonocytic leukemia (FAB type M4) t(11;19)(q23;p13) MLL+
Gill Super et al 1993 Blood 5189 5 Acute monoblastic leukemia without differentiation (FAB type M5a) t(6;11)(q27;q23) MLL+
Gill Super et al 1993 Blood 5189 6 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;19)(q23;p13) MLL+
Gill Super et al 1993 Blood 5189 7 Myelodysplastic syndrome, NOS t(9;11)(p21;q23) MLL+
Gill et al 1995 Genes Chromosomes Cancer 5849 1 Chondrosarcoma, myxoid Skeleton t(9;22)(q22;q12) EWSR1+
Gilles et al 2000 Blood 8559 1 Mature B-cell neoplasm, NOS t(1;14)(q21;q32) IGH@+
Giovannini et al 1994 J Clin Invest 5534 1 Neuroblastoma Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Giovannini et al 1994 J Clin Invest 5534 2 Peripheral neuroepithelioma Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Giovannini et al 1994 J Clin Invest 5534 3 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(11;22)(q24;q12) EWSR1/FLI1
Giovannini et al 1994 J Clin Invest 5534 4 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(2;11;22;21)(q32;q24;q12;p11) EWSR1/FLI1
Giovannini et al 1994 J Clin Invest 5534 5 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(21;22)(q22;q12) EWSR1/ERG
Giovannini et al 1994 J Clin Invest 5534 6 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(11;22)(q24;q12) EWSR1/FLI1
Giovannini et al 1994 J Clin Invest 5534 7 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(21;22)(q22;q12) EWSR1/ERG
Gisselsson et al 1998 Genes Chromosomes Cancer 7654 1 Atypical lipomatous tumor/atypical lipoma/well-differentiated liposarcoma Soft tissue +r(12) +TSPAN31,+CDK4,+HMGA2,+MDM2
Gisselsson et al 1998 Genes Chromosomes Cancer 7654 2 Atypical lipomatous tumor/atypical lipoma/well-differentiated liposarcoma Soft tissue +der(12) +TSPAN31,+CDK4,+HMGA2,+MDM2
Gisselsson et al 1998 Genes Chromosomes Cancer 7654 3 Osteosarcoma, periosteal Skeleton +r(12) +MDM2,+HMGA2,+CDK4,+TSPAN31
Gisselsson et al 1998 Genes Chromosomes Cancer 7654 4 Osteosarcoma, periosteal Skeleton +der(12) +CCND2,+KRAS
Gisselsson et al 1998 Genes Chromosomes Cancer 7654 5 Lipoma Soft tissue +r(12) +TSPAN31,+CDK4,+HMGA2,+MDM2
Gisselsson et al 1998 Cancer Lett 7889 1 Dermatofibrosarcoma protuberans/Bednar tumor/giant cell fibroblastoma Soft tissue +der(22)t(17;22)(q21;q13) +COL1A1/PDGFB
Gisselsson et al 2000 Genes Chromosomes Cancer 8608 1 Malignant fibrous histiocytoma Soft tissue +r(12)(q14q15) +MDM2,+CDK4
Gisselsson et al 2001 Am J Pathol 11158 1 Lipoblastoma Soft tissue der(8)(q12) PLAG1+
Gisselsson et al 2002 Genes Chromosomes Cancer 9346 1 Osteosarcoma, parosteal Skeleton +r +KRAS,+CDK4,+MDM2
Gisselsson et al 2002 Genes Chromosomes Cancer 9346 2 Osteosarcoma, periosteal Skeleton +r +CDK4,+MDM2
Giugliano et al 2001 Leukemia 9447 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(6;11;7)(q27;q23;q22) MLL/MLLT4
Goddard et al 1991 Science 4002 1 Acute promyelocytic leukemia (FAB type M3) t(15;17)(q22;q21) PML/RARA
Gokden et al 2003 J Cutan Pathol 10317 1 Dermatofibrosarcoma protuberans/Bednar tumor/giant cell fibroblastoma Vagina t(17;22)(q21;q13) COL1A1/PDGFB
Golub et al 1994 Cell 5480 1 Chronic myelomonocytic leukemia t(5;12)(q32;p13) ETV6/PDGFRB
Golub et al 1995 Proc Natl Acad Sci U S A 6004 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;21)(p13;q22) ETV6/RUNX1
Gonzalez & Notohamiprodjo 1996 Cancer Genet Cytogenet 6666 1 Acute undifferentiated leukemia t(6;9;22)(p25;q34;q11) BCR/ABL1
Gonzalez Garcia et al 1997 Cancer Genet Cytogenet 7146 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(9;22)(q34;q11) BCR/ABL1
González Garcia et al 2004 Cancer Genet Cytogenet 10662 1 Bilineage or biphenotypic leukemia t(1;9)(q23-25;q34) ABL1+
Gordon et al 2003 Cancer Genet Cytogenet 9923 1 Pleomorphic rhabdomyosarcoma Soft tissue t(2;13)(q36;q14) PAX3/FOXO1
Gore et al 2000 Leukemia 9004 1 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(10;11)(p12;q23q13) MLL/MLLT10
Gore et al 2000 Leukemia 9004 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(10;11)(p12;q23q13) MLL/MLLT10
Gore et al 2000 Leukemia 9004 3 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) ins(10;11)(p12;q23q13) MLL/MLLT10
Gorello et al 2008 Leukemia 12305 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(5;12)(q32;p13) ERC1/PDGFRB
Gorello et al 2008 Haematologica 12669 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(3;11)(q12;p15) NUP98/LNP1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 1 Chronic myeloid leukemia, aberrant translocation t(X;9;22)(q24;q34;q11) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 2 Chronic myeloid leukemia, aberrant translocation t(8;9;22)(p23;q34;q11) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 3 Chronic myeloid leukemia, aberrant translocation t(9;21;22)(q34;q22;q11) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 4 Chronic myeloid leukemia, aberrant translocation t(9;22;13)(q34;q11;q14) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 5 Chronic myeloid leukemia, aberrant translocation t(9;22;12)(q34;q11;p13) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 6 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p34;q34;q11) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 7 Chronic myeloid leukemia, aberrant translocation t(9;22;12)(q34;q11;q24) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 8 Chronic myeloid leukemia, aberrant translocation t(9;22;9)(q34;q11;p13) BCR/ABL1
Gorusu et al 2007 Cancer Genet Cytogenet 11825 9 Chronic myeloid leukemia, aberrant translocation t(9;22;17)(q34;q11;q23) BCR/ABL1
Goto et al 1994 Int J Hematol 5731 1 Acute myelomonocytic leukemia (FAB type M4) t(9;11)(p21;q23) MLL/MLLT3
Gould et al 2000 Am J Dermatopathol 8981 1 Anaplastic large cell lymphoma, cutaneous type t(2;5)(p23;q35) NPM1/ALK
Gozzetti et al 2002 Cancer Res 9721 2 Diffuse large B-cell lymphoma t(1;14;5)(q21;q32;p15) IGH@+
Gozzetti et al 2002 Cancer Res 9721 3 Diffuse large B-cell lymphoma t(14;19)(q32;p13) IGH@+
Gozzetti et al 2002 Cancer Res 9721 4 Follicular lymphoma t(2;14;14)(p13;q32;q32) IGH@+
Gozzetti et al 2002 Cancer Res 9721 5 Chronic lymphocytic leukemia t(14;19)(q32;p13) IGH@+
Gozzetti et al 2002 Cancer Res 9721 6 Diffuse large B-cell lymphoma t(14;19)(q32;p13) IGH@+
Gozzetti et al 2004 Cancer Genet Cytogenet 10485 1 Chronic myeloid leukemia, aberrant translocation t(9;22;19)(q34;q11;p13) BCR/ABL1
Graham & Adams 1986 EMBO J 1982 1 Burkitt lymphoma/leukemia t(2;8)(p11;q24) IGK@/PVT1
Grand et al 2004 Genes Chromosomes Cancer 10529 1 Acute myeloid leukemia, NOS ins(12;8)(p11;p11p22) FGFR1OP2/FGFR1
Grand et al 2004 Cancer Res 11794 1 Chronic myeloproliferative disorder, NOS t(5;15)(q32;q15) TP53BP1/PDGFRB
Grand et al 2005 Leuk Res 11252 1 Chronic myeloid leukemia, t(9;22) t(9;11)(p22;p15) NUP98/PSIP1
Grand et al 2007 Exp Hematol 12255 1 Atypical chronic myeloid leukemia t(2;13;2;21)(p16;q12;q33;q12) SPTBN1/FLT3
Graux et al 2004 Nat Genet 10756 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma r(9)(q34q34) +NUP214/ABL1
Gravel et al 1998 Blood 7517 1 Hodgkin disease, mixed cellularity t(14;18)(q32;q21) IGH@/BCL2
Greco et al 1992 Oncogene 9702 1 Adenocarcinoma Thyroid inv(1)(q21q31) TPM3/TPR
Greco et al 1993 Genomics 12585 1 Adenocarcinoma Thyroid inv(1)(q23q31) TPR/NTRK1
Greco et al 1995 Mol Cell Biol 9700 1 Adenocarcinoma Thyroid t(1;3)(q23;q12) TFG/NTRK1
Greco et al 1997 Genes Chromosomes Cancer 12583 1 Adenocarcinoma Thyroid inv(1)(q23q31) TPR/NTRK1
Griesinger et al 2002 Br J Haematol 9912 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;10;12)(q25;p13;p13) ETV6/ABL2
Griesinger et al 2005 Genes Chromosomes Cancer 11196 1 Chronic myeloproliferative disorder, NOS t(9;22)(p24;q11) BCR/JAK2
Griffin et al 1999 Cancer Res 8128 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intrathoracal t(2;17)(p23;q23) ALK+
Griffin et al 1999 Cancer Res 8128 2 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intraabdominal der(2)(p23) ALK+
Grimaldi & Meeker 1989 Blood 2970 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;14)(q31;q32) IGH@/IL3
Grimwade et al 1996 Br J Haematol 6714 1 Acute promyelocytic leukemia (FAB type M3) t(2;15;17)(p21;q22;q21) PML/RARA
Grimwade et al 1996 Br J Haematol 6714 2 Acute promyelocytic leukemia (FAB type M3) t(15;?18;17)(q22;?q22;q21) PML/RARA
Grimwade et al 1997 Blood 7174 1 Acute promyelocytic leukemia (FAB type M3) ins(15;17)(q22;q21q21) PML/RARA
Grimwade et al 1997 Blood 7174 2 Acute promyelocytic leukemia (FAB type M3) ins(17;15)(q21;q22q22) PML/RARA
Grimwade et al 2000 Blood 8691 1 Acute promyelocytic leukemia (FAB type M3) ins(11;17)(q23;q21q21) ZBTB16/RARA
Grimwade et al 2000 Blood 8691 2 Acute promyelocytic leukemia (FAB type M3) t(2;19;17;15)(p24;p13;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 3 Acute promyelocytic leukemia (FAB type M3) t(1;17;15)(p32;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 4 Acute promyelocytic leukemia (FAB type M3) t(7;17;15)(q22;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 5 Acute promyelocytic leukemia (FAB type M3) t(6;17;15)(p21;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 6 Acute promyelocytic leukemia (FAB type M3) t(8;17;15)(q22;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 7 Acute promyelocytic leukemia (FAB type M3) t(13;17;15)(p13;q21;q22) PML/RARA
Grimwade et al 2000 Blood 8691 8 Acute promyelocytic leukemia (FAB type M3) t(5;17;15)(q14;q21;q22) PML/RARA
Groffen et al 1984 Cell 1945 1 Chronic myeloid leukemia, t(9;22) t(9;22)(q34;q11) BCR+
Gu et al 1992 Cell 4516 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL/AFF1
Gu et al 2003 Leukemia 11137 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;12)(p15;q13) NUP98/HOXC11
Gu et al 2003 Leukemia 11137 2 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;12)(p15;q13) NUP98/HOXC11
Gu et al 2007 Blood 12124 1 Acute megakaryoblastic leukemia (FAB type M7) t(3;5)(p21;q33) RBM6/CSF1R
Guasch et al 2000 Blood 8489 1 Chronic myeloproliferative disorder, NOS t(8;9)(p11;q33) CEP110/FGFR1
Guasch et al 2003 Blood 9909 1 Chronic myeloproliferative disorder, NOS t(8;19)(p11;q13) HERVK/FGFR1
Guastadisegni et al 2008 Mol Cancer 12662 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;11)(q11;p15) HPS5+,DA926692+
Guastadisegni et al 2010 Leukemia 13350 1 Acute myeloid leukemia, NOS ins(21;20)(q22;q11q11) RUNX1/CBFA2T2
Guastadisegni et al 2010 Leukemia 13350 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(20;21)(q11;q22) RUNX1/C20ORF112
Gudi et al 1996 Cancer Genet Cytogenet 6652 1 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(p16;q34;q11) BCR/ABL1
Guerra et al 2008 Cancer Res 12782 1 Adenocarcinoma Stomach t(1;11)(p32;q13) CCND1/TACSTD2
Guerra et al 2008 Cancer Res 12782 2 Adenocarcinoma Large intestine t(1;11)(p32;q13) CCND1/TACSTD2
Guerra et al 2008 Cancer Res 12782 3 Adenocarcinoma Breast t(1;11)(p32;q13) CCND1/TACSTD2
Guerra et al 2008 Cancer Res 12782 4 Adenocarcinoma Uterus, corpus t(1;11)(p32;q13) CCND1/TACSTD2
Guerra et al 2008 Cancer Res 12782 5 Carcinoma, NOS Kidney t(1;11)(p32;q13) CCND1/TACSTD2
Guerra et al 2008 Cancer Res 12782 6 Adenocarcinoma Ovary t(1;11)(p32;q13) CCND1/TACSTD2
Guillaume et al 2000 Cancer Genet Cytogenet 8279 1 Chronic myeloid leukemia, aberrant translocation t(9;22;21)(q34;q11;q22) BCR/ABL1
Guillou et al 2007 Am J Surg Pathol 12153 1 Fibrosarcoma/sclerosing epithelioid fibrosarcoma Soft tissue t(7;16)(q34;p11) FUS/CREB3L2
Guillou et al 2007 Am J Surg Pathol 12153 2 Fibromyxoid sarcoma Soft tissue t(11;16)(p11;p11) FUS/CREB3L1
Gunawardena et al 1999 J Pediatr Hematol Oncol 8052 1 Osteosarcoma, NOS Skeleton hsr +MYC
Gutierrez et al 1999 Haematologica 8170 1 Acute promyelocytic leukemia (FAB type M3) ins(15;17)(q22;q21q21) PML/RARA
Hagemeijer et al 1998 Leukemia 7447 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;9;21)(q22;?;q22) RUNX1/RUNX1T1
Hagemeijer et al 1998 Leukemia 7447 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;13;21)(q22;?;q22) RUNX1/RUNX1T1
Hahn et al 2004 Proc Natl Acad Sci U S A 11246 1 Adenocarcinoma Breast t(3;6)(q26;q25) TBL1XR1/RGS17
Hallor et al 2007 Cancer Lett 11953 1 Angiomatoid malignant fibrous histiocytoma Soft tissue t(12;22)(q13;q12) EWSR1/ATF1
Hallor et al 2008 Mod Pathol 12870 1 Mixed tumor/Myoepithelial tumor/Parachordoma Soft tissue del(8)(q12q?) PLAG1+
Hallor et al 2009 J Pathol 12793 1 Fibroblastic/myofibroblastic tumor, special type Soft tissue t(1;10)(p22;q24) MGEA5+,TGFBR3+
Hallor et al 2009 J Pathol 12793 2 Fibroblastic/myofibroblastic tumor, special type Soft tissue r(3) +CHMP2B,+POU5F1,+VGLL3
Haltrich et al 2006 Cancer Genet Cytogenet 11282 1 Chronic myeloid leukemia, aberrant translocation t(9;14;22)(q34;q32;q11) BCR/ABL1
Hamada et al 1998 Br J Haematol 7794 1 Diffuse large B-cell lymphoma t(9;14)(p13;q32) IGH@/PAX5
Hamaguchi et al 1998 Br J Haematol 7879 1 Acute myelomonocytic leukemia (FAB type M4) t(6;9)(p22;q34) DEK/NUP214
Hamlyn & Rabbitts 1983 Nature 2080 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) IGH@/MYC
Han et al 2008 Cancer Res 12601 1 Adenocarcinoma Prostate t(1;21)(q32;q22) SLC45A3/ERG
Han et al 2008 Cancer Res 12601 2 Adenocarcinoma Prostate t(7;17)(p21;p13) FLJ35294/ETV1
Han et al 2008 Cancer Res 12601 3 Adenocarcinoma Prostate t(17;17)(q25;q21) CANT1/ETV4
Han et al 2008 Cancer Res 12601 4 Adenocarcinoma Prostate t(17;17)(q21;q24) DDX5/ETV4
Han et al 2008 Cancer Genet Cytogenet 12645 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;14)(q11;q32) IGH@/CEBPE
Hanamura et al 2001 Jpn J Cancer Res 9289 1 Multiple myeloma t(14;20)(q32;q12) IGH@/MAFB
Hansen-Hagge et al 2002 Leukemia 9863 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;14)(q35;q11) TRD@/RANBP17
Hansen-Hagge et al 2002 Leukemia 9863 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;14)(q35;q11) TRD@/TLX3
Hansen Hallor et al 2005 Genes Chromosomes Cancer 11050 1 Angiomatoid malignant fibrous histiocytoma Soft tissue t(12;22)(q13;q12) EWSR1/ATF1
Hao et al 2002 Mod Pathol 10086 1 Mantle cell lymphoma add(8)(q24) MYC+
Hao et al 2002 Mod Pathol 10086 2 Mantle cell lymphoma t(2;8)(q13;q24) MYC+
Haraguchi et al 2009 Leuk Res 12967 1 Acute promyelocytic leukemia (FAB type M3) ins(4;15)(q21;q?q22)t(15;17)(q22;q21) PML/RARA
Harbott et al 1998 Leukemia 7522 1 Refractory anemia with excess of blasts (FAB) del(11)(q13q23) MLL+
Harbott et al 1998 Leukemia 7522 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(11)(q14q23) MLL+
Harbott et al 1998 Leukemia 7522 3 Acute monoblastic leukemia with differentiation (FAB type M5b) del(11)(q23) MLL+
Harbott et al 1998 Leukemia 7522 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(11)(q23) MLL+
Harbott et al 1998 Leukemia 7522 5 Acute myelomonocytic leukemia (FAB type M4) del(11)(q23) MLL+
Harbott et al 1998 Leukemia 7522 6 Acute myeloblastic leukemia with maturation (FAB type M2) del(11)(q23q23) MLL+
Harbott et al 1998 Leukemia 7522 7 Acute myeloblastic leukemia without maturation (FAB type M1) del(11)(q23) MLL+
Harbott et al 1998 Leukemia 7522 8 Acute myeloblastic leukemia with maturation (FAB type M2) del(11)(q23) MLL+
Harigae et al 1997 Tohoku J Exp Med 7595 1 Acute myelomonocytic leukemia (FAB type M4) t(16;21)(p11;q22) FUS/ERG
Hariharan et al 1989 Mol Cell Biol 3160 1 Mature B-cell neoplasm, NOS t(9;22)(q34;q11) BCR/ABL1
Hariharan et al 1989 Mol Cell Biol 3160 2 Mature T- and NK-cell neoplasm, NOS t(9;22)(q34;q11) BCR/ABL1
Harrison et al 1998 Leukemia 7521 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;11)(p32;q23) MLL+
Harrison et al 1998 Leukemia 7521 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(1;11)(p32;q23) MLL+
Harrison et al 1998 Leukemia 7521 3 Acute monoblastic leukemia with differentiation (FAB type M5b) add(11)(q23) MLL+
Harrison et al 1998 Leukemia 7521 4 Acute myelomonocytic leukemia (FAB type M4) ins(3;11)(p21;q13q23) MLL+
Harrison et al 1998 Leukemia 7521 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;11)(q31;q23) MLL+
Harrison et al 1998 Leukemia 7521 6 Acute myelomonocytic leukemia (FAB type M4) t(6;11)(q13;q23) MLL+
Harrison et al 1998 Leukemia 7521 7 Acute monoblastic leukemia with differentiation (FAB type M5b) t(10;11)(q25;q23) MLL+
Harrison et al 1998 Leukemia 7521 8 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;11)(q13;q23) MLL+
Harrison et al 1998 Leukemia 7521 9 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;13;11)(q21;q34;q23) MLL+
Harrison et al 1998 Leukemia 7521 10 Acute myelomonocytic leukemia (FAB type M4) t(11;15)(q23;q14) MLL+
Harrison et al 1998 Leukemia 7521 11 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;17)(q23;p13) MLL+
Harrison et al 1998 Leukemia 7521 12 Acute myeloblastic leukemia without maturation (FAB type M1) t(11;17)(q23;q25) MLL+
Harrison et al 1998 Leukemia 7521 13 Acute myeloblastic leukemia without maturation (FAB type M1) t(11;17)(q23;q23) MLL+
Harrison et al 1998 Leukemia 7521 14 Acute myelomonocytic leukemia (FAB type M4) t(11;17)(q23;q25) MLL+
Harrison et al 1998 Leukemia 7521 15 Myelodysplastic syndrome, NOS inv(11)(p14q23) MLL+
Harrison et al 1998 Leukemia 7521 16 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(11)(q23) MLL+
Harrison et al 1999 Cancer Genet Cytogenet 8099 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;8;21)(q22;p23;q22) RUNX1/RUNX1T1
Harrison et al 1999 Cancer Genet Cytogenet 8099 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;19;21)(q22;?q13;q22) RUNX1/RUNX1T1
Harrison et al 1999 Cancer Genet Cytogenet 8099 3 Acute myeloblastic leukemia with maturation (FAB type M2) ins(21;8)(q22;q21q22) RUNX1/RUNX1T1
Haruki et al 2005 J Med Genet 11472 1 Carcinoma, NOS Lung t(15;19)(q14;p13) BRD4/C15orf55
Harvey et al 1989 Oncogene 2956 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRD@+
Hashii et al 2004 Leukemia 10676 1 Acute myelomonocytic leukemia (FAB type M4) t(11;12)(q23;q13) MLL/CIP29
Hatano et al 2008 Anticancer Res 12446 1 Lipoma Soft tissue t(2;12)(q37;q14) HMGA2/CXCR7
Hattinger et al 1996 Genes Chromosomes Cancer 6690 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(6;11;22)(p21;q24;q12) EWSR1/FLI1
Hattinger et al 1999 Genes Chromosomes Cancer 7885 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(2;22)(q35;q12) EWSR1/FEV
Hatzivassiliou et al 2001 Immunity 12580 1 Multiple myeloma t(1;14)(q23;q32) IGH@/FCRL4
Hauer et al 2008 Pediatr Blood Cancer 12346 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(7;12)(q36;p13) MNX1/ETV6
Hayami et al 2003 Leukemia 10186 1 Multiple myeloma t(1;14)(p35;q32) IGH@+,LAPTM5+
Hayashi et al 1986 N Engl J Med 1555 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRA@/MYC
Hayashi et al 1986 N Engl J Med 1555 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRA@+
Hayashi et al 1989 Cancer 2751 1 Neuroblastoma Adrenal hsr +MYCN
Hayashi et al 1989 Cancer 2751 2 Neuroblastoma Adrenal dmin +MYCN
Hayashi et al 1990 Blood 3511 1 Acute monoblastic leukemia (FAB type M5) t(7;12)(q34;q22) TRB@+
Hayashi et al 1990 Blood 3511 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q?21;q32) IGH@+
Hayette et al 1998 Oncogene 7616 1 Chronic lymphocytic leukemia t(11;19)(q13;p13) FSTL3/CCND1
Hayette et al 2000 Oncogene 8830 1 Acute myelomonocytic leukemia (FAB type M4) t(11;15)(q23;q15) MLL/CASC5
Hayette et al 2003 Blood 10260 1 Chronic lymphocytic leukemia t(7;22)(q21;q11) IGL@/CDK6
Hayette et al 2003 Blood 10260 2 Chronic lymphocytic leukemia t(7;14)(q21;q32) IGH@/CDK6
Hayette et al 2003 Blood 10260 3 Chronic lymphocytic leukemia t(2;7)(p11;q21) IGK@/CDK6
Hayette et al 2005 Cancer Res 11106 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(p12;q23) MLL/FRYL
Hayman et al 2001 Blood 9279 1 Primary amyloidosis der(14)(q32) IGH@+
Hayman et al 2001 Blood 9279 2 Primary amyloidosis t(11;14)(q13;q32) IGH@/CCND1
Hazelbag et al 2004 Mod Pathol 10861 1 Synovial sarcoma Heart t(X;18)(p11;q11) SS18/SSX
Hebert et al 1993 Leukemia 5251 1 Diffuse large B-cell lymphoma t(3;22)(q27;q11) IGL@/BCL6
Heimann et al 2001 Cancer Res 9176 1 Adenocarcinoma Kidney t(X;17)(p11;q25) ASPSCR1/TFE3
Heisterkamp et al 1983 Nature 2082 1 Chronic myeloid leukemia, t(9;22) t(9;22)(q34;q11) ABL1+
Heisterkamp et al 1985 Nature 1979 1 Chronic myeloid leukemia, t(9;22) t(9;22)(q34;q11) BCR/ABL1
Heisterkamp et al 1989 Blood 2917 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(22)(q11q13) BCR+
Helgeson et al 2008 Cancer Res 12290 1 Adenocarcinoma Prostate t(3;21)(q27;q22) TMPRSS2/ETV5
Helgeson et al 2008 Cancer Res 12290 2 Adenocarcinoma Prostate t(1;3)(q32;q27) SLC45A3/ETV5
Hemmings & Fisher 2004 Pathology 10610 1 Synovial sarcoma Intraabdominal t(X;18)(p11;q11) SS18/SSX1
Henglein et al 1989 Mol Cell Biol 3036 1 Burkitt lymphoma/leukemia t(2;8)(p11;q24) IGK@/PVT1
Hennig et al 1997 Cancer Genet Cytogenet 7015 1 Leiomyoma Uterus, corpus t(2;3;12)(q35;p21;q14) HMGA2+
Heppell et al 1988 Hum Genet 2557 1 Nonneoplastic lymphatic disorder/lesion t(X;14)(q28;q11) TRA@+
Heppell et al 1988 Hum Genet 2557 2 Nonneoplastic lymphatic disorder/lesion t(14;14)(q11;q32) TRA@+
Herens et al 2008 Blood 12339 1 Mantle cell lymphoma t(12;14)(p13;q32) IGH@/CCND2
Hermans et al 1987 Cell 2215 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;22)(q34;q11) BCR/ABL1
Hermans et al 1988 Leukemia 2582 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;17;22)(q34;?;q11) BCR/ABL1
Hermans et al 1988 Leukemia 2582 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;14;22)(q34;?;q11) BCR/ABL1
Hermans et al 1988 Leukemia 2582 4 Acute myeloid leukemia, NOS t(9;22)(q34;q11) BCR/ABL1
Hermans et al 2006 Cancer Res 11717 1 Adenocarcinoma Prostate t(21;21)(q22;q22) TMPRSS2/ERG
Hermans et al 2006 Cancer Res 11717 2 Adenocarcinoma Prostate t(7;21)(p21;q22) TMPRSS2/ETV1
Hermans et al 2006 Cancer Res 11717 3 Adenocarcinoma Prostate del(21)(q22q22) TMPRSS2/ERG
Hermans et al 2008 Cancer Res 12458 1 Adenocarcinoma Prostate t(17;17)(q25;q21) CANT1/ETV4
Hermans et al 2008 Cancer Res 12458 2 Adenocarcinoma Prostate t(17;19)(q21;q13) KLK2/ETV4
Hermans et al 2008 Cancer Res 12602 1 Adenocarcinoma Prostate t(3;7)(p13;p21) FOXP1/ETV1
Hermans et al 2008 Cancer Res 12602 2 Adenocarcinoma Prostate t(7;14)(p21;q21) EST14/ETV1
Hermans et al 2008 Cancer Res 12602 3 Adenocarcinoma Prostate t(7;17)(p21;p13) HERVK17/ETV1
Hernandez et al 1995 Leukemia 6152 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;15)(q23;q14) MLL+
Hernandez et al 1999 Blood 8333 1 Anaplastic large cell lymphoma, systemic type t(2;3)(p23;q12) TFG/ALK
Hernández et al 2002 Am J Pathol 9549 1 Anaplastic large cell lymphoma, systemic type t(2;3)(p23;q12) TFG/ALK
Hibbard et al 2000 Cancer Res 8822 1 Lipoblastoma Soft tissue del(8)(q12q24) HAS2/PLAG1
Hibbard et al 2000 Cancer Res 8822 2 Lipoblastoma Soft tissue r(8;8)(q12;q24) HAS2/PLAG1
Hibbard et al 2000 Cancer Res 8822 3 Lipoblastoma Soft tissue t(7;8)(q21;q12) COL1A2/PLAG1
Hidalgo-Curtis et al 2008 Genes Chromosomes Cancer 12315 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;9)(p34;q34) SFPQ/ABL1
Hidalgo-Curtis et al 2008 Genes Chromosomes Cancer 12315 2 Chronic myeloproliferative disorder, NOS t(8;12)(p11;q15) CPSF6/FGFR1
Hidalgo-Curtis et al 2010 Br J Haematol 13399 1 Chronic myeloproliferative disorder, NOS t(1;3;5)(p36;p22;q32) WDR48/PDGFRB
Hidalgo-Curtis et al 2010 Br J Haematol 13399 2 Chronic myeloproliferative disorder, NOS t(3;5)(p22;q32) GOLGA4/PDGFRB
Hidalgo-Curtis et al 2010 Br J Haematol 13399 3 Chronic myeloproliferative disorder, NOS t(3;5)(p22;q32) GOLGA4/PDGFRB
Hidalgo-Curtis et al 2010 Br J Haematol 13399 4 Chronic myeloproliferative disorder, NOS t(5;12)(q32;q13) BIN2/PDGFRB
Hilden et al 1993 Cancer Res 5131 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q21;q23) MLL/AFF1
Hilden et al 1995 Blood 6207 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11;14)(q13;q23;q32) MLL+
Hilden et al 1995 Blood 6207 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q35;q23) MLL+
Hilden et al 1997 Blood 6897 1 Acute myeloid leukemia, NOS add(11)(q23) MLL+
Hilden et al 1997 Blood 6897 2 Acute myeloid leukemia, NOS t(7;11)(p22;q23) MLL+
Hilden et al 1997 Blood 6897 3 Acute myeloid leukemia, NOS del(11)(q23) MLL+
Hilden et al 1997 Blood 6897 4 Acute myeloid leukemia, NOS del(11)(q14q23) MLL+
Hilden et al 1997 Blood 6897 5 Acute myeloid leukemia, NOS t(10;11)(p11;q23) MLL+
Hillion et al 1991 Oncogene 3734 1 Follicular lymphoma t(2;18)(p11;q21) IGK@/BCL2
Hillion et al 1991 Oncogene 3734 2 Burkitt lymphoma/leukemia t(2;18)(p11;q21) IGK@/BCL2
Hillion et al 1991 Oncogene 3734 3 Diffuse large B-cell lymphoma t(2;18)(p11;q21) IGK@/BCL2
Hillion et al 1997 Blood 7165 1 Acute undifferentiated leukemia t(6;11)(q21;q23) MLL/FOXO3
Hinshaw et al 2004 Pediatr Dermatol 10786 1 Anaplastic large cell lymphoma, cutaneous type t(2;5)(p23;q35) NPM1/ALK
Hiraga et al 1997 Virchows Arch 9232 1 Clear cell sarcoma Soft tissue t(12;22)(q13;q12) EWSR1/ATF1
Hirata et al 1993 Cancer Genet Cytogenet 4724 1 Chronic myeloid leukemia, aberrant translocation t(5;9;22)(q13;q34;q11) BCR/ABL1
Hisaoka et al 1999 Histopathology 8152 1 Synovial sarcoma Lung t(X;18)(p11;q11) SS18/SSX1
Hisaoka et al 1999 Histopathology 8152 2 Synovial sarcoma Lung t(X;18)(p11;q11) SS18/SSX2
Hisaoka et al 2004 Genes Chromosomes Cancer 10663 1 Chondrosarcoma, myxoid Soft tissue t(3;9)(q12;q31) TFG/NR4A3
Hiwatari et al 2003 Oncogene 10133 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;11)(q11;q23) MLL/AFF3
Hiyoshi et al 1995 Br J Haematol 6086 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(16;21)(p11;q22) FUS/ERG
Hollis et al 1984 Nature 4508 1 Burkitt lymphoma/leukemia t(8;22)(q24;q11) IGL@/MYC
Hollis et al 1988 Mol Cell Biol 2406 1 Plasma cell leukemia add(8)(q24) MYC+
Horstmann et al 1996 Cancer Genet Cytogenet 6423 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;18;19)(q23;q22;p13) MLL/MLLT1
Hosokawa et al 2000 Blood 8620 1 Diffuse large B-cell lymphoma t(3;7)(q27;p12) IKZF1/BCL6
Hosoya et al 2005 Genes Chromosomes Cancer 10789 1 Acute myelomonocytic leukemia (FAB type M4) t(6;12)(q22;p13) ETV6/FRK
Howarth et al 2008 Oncogene 12494 1 Adenocarcinoma Breast t(2;7)(q23;p12) RIF1/PKD1L1
Howarth et al 2008 Oncogene 12494 2 Adenocarcinoma Breast t(7;20)(p15;q11) TAX1BP1/AHCY
Hromas et al 2000 Blood 8643 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(1;21)(p36;q22) RUNX1+
Hromas et al 2000 Blood 8643 2 Acute myeloid leukemia, NOS t(18;21)(q21;q22) RUNX1+
Hromas et al 2000 Blood 8643 3 Acute myeloblastic leukemia with maturation (FAB type M2) t(19;21)(q13;q22) RUNX1+
Hsiao et al 2005 Cancer Genet Cytogenet 10871 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(2;21;8)(q36;q22;q22) RUNX1/RUNX1T1
Hsiao et al 2005 Am J Hematol 11001 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(1;22)(p13;q13) RBM15/MKL1
Hu et al 2010 Blood 13175 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;14)(p13;q32) IGH@/CD44
Hu et al 2010 Blood 13175 2 Extranodal marginal zone B-cell lymphoma Unknown site t(11;14)(p13;q32) IGH@/CD44
Hu et al 2010 Blood 13175 3 Follicular lymphoma t(11;14)(p13;q32) IGH@/CD44
Hu et al 2010 Blood 13175 4 Diffuse large B-cell lymphoma t(11;14)(p13;q32) IGH@/CD44
Huang et al 1997 Br J Haematol 6990 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(7;11)(p15;p15) NUP98/HOXA9
Huang et al 1997 Br J Haematol 6990 2 Acute myelomonocytic leukemia (FAB type M4) t(7;11)(p15;p15) NUP98/HOXA9
Huang et al 2006 Am J Clin Pathol 11329 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(1;21;8)(q25;q22;q22) RUNX1/RUNX1T1
Huang et al 2006 Am J Clin Pathol 11329 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(4;21;8;12)(q31;q22;q22;q15) RUNX1/RUNX1T1
Huang et al 2008 Int J Hematol 12673 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(8;9)(p22;p24) PCM1/JAK2
Huang et al 2010 Genes Chromosomes Cancer 13288 1 Chondroid lipoma Soft tissue t(11;16)(q13;p13) C11ORF95/MKL2
Hudecek et al 2008 Acta Haematol 12439 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(11;15)(q23;q15) MLL+
Huebner et al 1985 Science 1957 1 Acute promyelocytic leukemia (FAB type M3) der(5)(q31) CSF2+
Hummel et al 1999 Oncogene 8010 1 Acute promyelocytic leukemia (FAB type M3) t(5;17)(q35;q21) NPM1/RARA
Hunger et al 1992 Genes Dev 4583 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(17;19)(q22;p13) TCF3/HLF
Hunger et al 1993 Blood 4936 1 Acute myeloid leukemia, NOS t(6;11)(q27;q23) MLL+
Hunger et al 1993 Blood 4936 2 Acute myeloid leukemia, NOS t(11;15)(q23;q15) MLL+
Hunger et al 1993 Blood 4936 3 Acute myeloid leukemia, NOS der(11)(q23) MLL+
Hunger et al 1993 Blood 4936 4 Acute myelomonocytic leukemia (FAB type M4) t(9;11)(p21;q23) MLL+
Hunger et al 1993 Blood 4936 5 Acute myelomonocytic leukemia (FAB type M4) t(11;19)(q23;p13) MLL+
Hunger et al 1993 Blood 4936 6 Acute monoblastic leukemia (FAB type M5) der(11)(q23) MLL+
Hunger et al 1993 Blood 4936 7 Acute monoblastic leukemia (FAB type M5) t(9;11)(p24;q23) MLL+
Hunger et al 1993 Blood 4936 8 Acute megakaryoblastic leukemia (FAB type M7) t(7;11)(p15;q23) MLL+
Hunger et al 1993 Blood 4936 9 Chronic myeloproliferative disorder, NOS t(1;11)(q32;q23) MLL+
Hunger et al 1993 Blood 4936 10 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;11)(q27;q23) MLL+
Hunger et al 1993 Blood 4936 11 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(11)(q23) MLL+
Hunger et al 1993 Blood 4936 12 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;16)(q23;p13) MLL+
Hussey et al 1999 Blood 8362 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(4;11)(q23;p15) NUP98/RAP1GDS1
Hussey et al 2001 BMC Genet 9938 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(9;11)(p22;p15) NUP98/PSIP1
Hebert et al 1994 Blood 5647 1 Acute myelomonocytic leukemia (FAB type M4) inv(16)(p13q22) CBFB/MYH11
Höglund et al 1996 Blood 6209 1 Acute myeloid leukemia, NOS t(12;22)(p13;q12) ETV6+
Höglund et al 1996 Blood 6209 2 Acute myeloid leukemia, NOS add(12)(p13) ETV6+
Höglund et al 1996 Blood 6209 3 Chronic myeloid leukemia, t(9;22) t(3;12)(q27;p13) ETV6+
Höglund et al 1996 Blood 6209 4 Myelodysplastic syndrome, NOS t(5;12)(q32-33;p13) ETV6+
Ibrahim et al 2000 Am J Clin Pathol 8939 1 Acute erythroleukemia (FAB type M6) der(11)(q23) MLL+
Ichikawa et al 1994 Cancer Res 5406 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(16;21)(p11;q22) FUS/ERG
Ichikawa et al 1994 Cancer Res 5406 2 Acute monoblastic leukemia (FAB type M5) t(16;21)(p11;q22) FUS/ERG
Ichikawa et al 1999 Mol Cell Biol 8417 1 Acute myeloid leukemia, NOS t(16;21)(p11;q22) FUS/ERG
Ichinohasama et al 1998 Cancer Genet Cytogenet 7453 1 Diffuse large B-cell lymphoma t(3;16)(q27;p11) BCL6+
Ichinohasama et al 1998 Cancer Genet Cytogenet 7536 1 Diffuse large B-cell lymphoma t(3;7)(q27;p12) BCL6+
Ichinohasama et al 1998 Am J Surg Pathol 8009 1 Primary effusion lymphoma t(9;14)(p13;q32) IGH@/PAX5
Ida et al 1997 Med Pediatr Oncol 6941 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL/MLLT1
Ida et al 1997 Blood 7440 1 Acute myeloid leukemia, NOS t(11;22)(q23;q13) MLL/EP300
Igarashi et al 1998 Jpn J Clin Oncol 7925 1 Acute myelomonocytic leukemia (FAB type M4) inv(3)(q21q26) EVI1+
Iida et al 1993 Jpn J Cancer Res 4977 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL+
Iida et al 1993 Oncogene 5172 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(9;11)(p21;q23) MLL/MLLT3
Iida et al 1993 Oncogene 5172 2 Acute monoblastic leukemia (FAB type M5) t(9;11)(p21;q23) MLL/MLLT3
Iida et al 1993 Oncogene 5172 3 Acute myelomonocytic leukemia (FAB type M4) t(9;11)(p21;q23) MLL/MLLT3
Iida et al 1996 Blood 6695 1 Lymphoplasmacytic lymphoma t(9;14)(p13;q32) IGH@/PAX5
Iida et al 1997 Nat Genet 7265 1 Multiple myeloma t(6;14)(p25;q32) IGH@/IRF4
Iida et al 1999 Leuk Lymphoma 8220 1 Lymphoplasmacytic lymphoma t(9;14)(p13;q32) IGH@/PAX5
Iida et al 1999 Leuk Lymphoma 8220 2 Mantle cell lymphoma t(9;14)(p13;q32) PAX5+
Iida et al 1999 Leuk Lymphoma 8220 3 Diffuse large B-cell lymphoma t(3;9)(q27;p13) PAX5+
Iida et al 2000 Int J Hematol 8848 1 Multiple myeloma t(8;22)(q24;q11) IGL@/MYC
Iida et al 2000 Int J Hematol 8848 2 Multiple myeloma t(2;11)(p11;q23) IGK@+
Iijima et al 2000 Blood 8655 1 Acute promyelocytic leukemia (FAB type M3) t(1;12)(q25;p13) ETV6/ABL2
Ikeda et al 1999 Int J Hematol 8169 1 Acute myelomonocytic leukemia (FAB type M4) inv(11)(p15q22) NUP98/DDX10
Iljin et al 2006 Cancer Res 11718 1 Adenocarcinoma Prostate del(21)(q22q22) TMPRSS2/ERG
Iljin et al 2006 Cancer Res 11718 2 Adenocarcinoma Prostate t(17;21)(q21;q22) TMPRSS2/ETV4
Imagama et al 2007 Eur J Haematol 11999 1 Acute myeloid leukemia, NOS t(11;21)(q13;q22) RUNX1/MACROD1
Imamura et al 2002 Leukemia 9865 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;11)(q31;q23) MLL/AFF4
Imamura et al 2003 Genes Chromosomes Cancer 9975 1 Myelodysplastic syndrome, NOS t(2;8)(p23;p11) MYST3+
Imashuku et al 1996 Med Pediatr Oncol 6493 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;11)(q35;q23) MLL+
Impera et al 2008 Oncogene 12600 1 Follicular lymphoma t(2;18)(q11;q21) AFF3/BCL2
Inaba et al 1991 Leukemia 4013 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;14)(p13;q32) IGH@+
Inaba et al 1992 Science 4268 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(17;19)(q22;p13) TCF3/HLF
Inagaki et al 1999 Am J Clin Pathol 8072 1 Synovial sarcoma Oro- and hypopharynx t(X;18)(p11;q11) SS18/SSX1
Ingraham et al 1999 Cancer Genet Cytogenet 8273 1 Leiomyoma Uterus, corpus t(12;14)(q15;q24) RAD51L1+
Inukai et al 1998 Leukemia 7279 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;15)(q23;q14-15) MLL+
Iqbal et al 2007 Cancer Genet Cytogenet 12110 1 Diffuse large B-cell lymphoma t(3;11)(q27;p14) BCL6+
Ishida et al 2002 Cancer Genet Cytogenet 9390 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;21;14)(q22;q22;q24) RUNX1/RUNX1T1
Ishiguro et al 2004 Oncol Rep 11192 1 Adenocarcinoma Kidney t(X;17)(p11;q25) ASPSCR1/TFE3
Ishii et al 1995 Leukemia 6253 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(10;11)(p11;q23) MLL+
Ishikawa et al 2007 Int J Hematol 12233 1 Acute myeloid leukemia, NOS t(3;5;11)(p24;q35;p15) ANKRD28/NUP98
Isobe et al 1990 Cancer Res 3615 1 Adult T-cell lymphoma/leukemia (HTLV-1+) inv(14)(q11q32) TRA@+
Isobe et al 1990 Cancer Res 3615 2 Adult T-cell lymphoma/leukemia (HTLV-1+) t(12;14)(q24;q11) TRA@+
Isobe et al 1990 Cancer Res 3615 3 Adult T-cell lymphoma/leukemia (HTLV-1+) t(14;14)(q11;q32) TRA@+
Isobe et al 1990 Cancer Res 3615 4 Adult T-cell lymphoma/leukemia (HTLV-1+) del(14)(q11q13) TRA@+
Isobe et al 1990 Cancer Res 3615 5 Adult T-cell lymphoma/leukemia (HTLV-1+) t(3;14)(q12;q11) TRA@+
Italiano et al 2008 Genes Chromosomes Cancer 12570 1 Lipoma Soft tissue t(9;12)(p22;q14) HMGA2+
Italiano et al 2008 Genes Chromosomes Cancer 12570 2 Lipoma Intraabdominal t(9;12)(p22;q14) HMGA2/NFIB
Italiano et al 2008 Genes Chromosomes Cancer 12570 3 Lipoma Soft tissue t(9;12)(p22;q14) HMGA2/NFIB
Italiano et al 2008 Genes Chromosomes Cancer 12570 4 Lipoma Large intestine t(9;16;19)(p22;q21;q13) NFIB+
Iwama et al 1996 Cancer Genet Cytogenet 6221 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;22)(q34;q11) BCR/ABL1
Iwase et al 2003 Genes Chromosomes Cancer 10132 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;20)(p15;q12) NUP98/TOP1
Jacob et al 1997 Bone Marrow Transplant 7295 1 Chronic myeloid leukemia, aberrant translocation t(9;22;10)(q34;q11;p11) BCR+
Jadayel et al 1994 Blood 5681 1 Lymphoplasmacytic lymphoma t(11;14)(q13;q32) CCND1+
Jadayel et al 1994 Blood 5681 2 Splenic marginal zone B-cell lymphoma t(11;14)(q13;q32) CCND1+
Jadayel et al 1995 Leukemia 6075 1 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(p23;q34;q11) BCR/ABL1
Jaju et al 2001 Blood 9198 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(5;11)(q35;p15) NUP98/NSD1
Jamal et al 2001 Genes Chromosomes Cancer 8904 5 Refractory anemia with excess of blasts (FAB) der(11)(q23) MLL+
Jani Sait et al 1993 Genes Chromosomes Cancer 4770 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;12)(q23;p13) MLL+
Jankovic et al 2008 Blood 12507 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(10;11)(q23;p15) NUP98/HHEX
Janssen et al 2006 Haematologica 12474 1 Acute myeloid leukemia, NOS t(10;12)(q24;p13) ETV6/GOT1
Jarosova et al 2005 Cancer Genet Cytogenet 11220 1 Acute monoblastic leukemia (FAB type M5) ins(10;11)(p12;q23q23) MLL/MLLT10
Jay et al 1994 Cancer 5428 1 Glioma, NOS Brain dmin +MYCN
Jay et al 1996 Pediatr Pathol Lab Med 6780 1 Primitive neuroectodermal tumor/Medulloblastoma Cerebellum t(11;22)(q24;q12) EWSR1/FLI1
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 1 Myelodysplastic syndrome, NOS t(1;21)(q21;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 2 Chronic myeloid leukemia, t(9;22) t(2;21)(p21;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 3 Acute megakaryoblastic leukemia (FAB type M7) t(3;21)(p12;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;21)(q21;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 5 Acute monoblastic leukemia (FAB type M5) t(4;21)(q35;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;21)(p12-13;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 7 Acute erythroleukemia (FAB type M6) t(7;21)(p14-15;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 8 Acute myelomonocytic leukemia (FAB type M4) t(7;21)(p15;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 9 Chronic myeloid leukemia, t(9;22) t(20;21)(q11;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 10 Chronic myeloid leukemia, t(9;22) t(X;21)(p11;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 11 Acute myelomonocytic leukemia (FAB type M4) t(3;21)(q26;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 12 Refractory anemia with excess of blasts (FAB) t(3;21)(q26;q22) RUNX1+
Jeandidier et al 2006 Cancer Genet Cytogenet 11416 13 Acute myeloblastic leukemia with maturation (FAB type M2) t(3;21)(q26;q22) RUNX1+
Jeon et al 1995 Oncogene 5861 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skin t(7;22)(p21;q12) EWSR1/ETV1
Jin et al 1998 Genes Chromosomes Cancer 7463 1 Squamous cell carcinoma Oral cavity hsr +CCND1
Jin et al 1998 Genes Chromosomes Cancer 7463 2 Undifferentiated carcinoma Nasopharynx hsr +CCND1
Jin et al 1998 Genes Chromosomes Cancer 7463 3 Squamous cell carcinoma Oro- and hypopharynx hsr +CCND1
Jin et al 1998 Genes Chromosomes Cancer 7463 4 Squamous cell carcinoma Larynx hsr +CCND1
Jin et al 1998 Genes Chromosomes Cancer 7463 5 Squamous cell carcinoma Tongue hsr +CCND1
Jin et al 2001 Genes Chromosomes Cancer 8853 1 Adenoma Salivary gland ins(8;14)(q12;q?24q?32) PLAG1+
Jin et al 2001 Genes Chromosomes Cancer 8853 2 Malignant epithelial tumor, special type Salivary gland t(3;8)(p23;q12) PLAG1+
Jin et al 2004 Cancer Genet Cytogenet 10415 1 Squamous cell carcinoma Oesophagus hsr +CCND1
Jin et al 2006 Neoplasia 11576 1 Teratoma (mature and immature) Intrathoracal t(8;22)(p21;q12) PPP2R2A/CHEK2
Jinawath et al 2010 Cancer Genet Cytogenet 13296 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(1;21;7)(q25;q22;q22) EWSR1/ERG
Joh et al 1996 Oncogene 6782 1 Acute myeloid leukemia, NOS t(9;11)(p21;q23) MLL/MLLT3
Joh et al 1997 Oncogene 7415 1 Acute myeloid leukemia, NOS t(6;11)(q27;q23) MLL/MLLT4
Johansson et al 1996 Br J Haematol 6216 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(3;21)(q26;q22) RUNX1+
Johansson et al 2000 Genes Chromosomes Cancer 8385 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;17)(q23;q21) MLL+
Johnson et al 2009 Blood 12994 1 Mature B-cell neoplasm, NOS t(3;8)(q27;q24) MYC+
Johnson et al 2009 Blood 12994 2 Diffuse large B-cell lymphoma t(5;8)(q31;q24) MYC+
Johnson et al 2009 Blood 12994 3 Diffuse large B-cell lymphoma t(3;8)(?p25;q24) MYC+
Johnson et al 2009 Blood 12994 4 Mature B-cell neoplasm, NOS t(8;22)(q24;q11) MYC+
Johnson et al 2009 Blood 12994 5 Mature B-cell neoplasm, NOS t(2;8)(p11;q24) MYC+
Johnson et al 2009 Blood 12994 6 Diffuse large B-cell lymphoma add(8)(q24) MYC+
Johnson et al 2009 Blood 12994 7 Mature B-cell neoplasm, NOS t(1;8)(p34;q24) MYC+
Jones et al 2001 Leukemia 9190 1 Acute megakaryoblastic leukemia (FAB type M7) t(10;11)(p12;q14) PICALM/MLLT10
Jones et al 2003 Leukemia 10360 1 Acute monoblastic leukemia (FAB type M5) ins(10;11)(p12;q23q23) MLL/MLLT10
Jones et al 2008 Cancer Res 13364 1 Astrocytoma, pilocytic/juvenile Brain dup(7)(q34q34) KIAA1549/BRAF
Jones et al 2009 Oncogene 12838 1 Astrocytoma, pilocytic/juvenile Brain dup(3)(p25p25) SRGAP3/RAF1
Jonveaux et al 1992 Br J Haematol 4646 1 Chronic lymphocytic leukemia t(14;18)(q32;q21) IGH@/BCL2
Jonveaux et al 1994 Leukemia 5844 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(6;11)(q27;q23) MLL+
Jun et al 2008 Int J Surg Pathol 12606 1 Synovial sarcoma Prostate t(X;18)(p11;q11) SS18/SSX
Just et al 2010 Ann Diagn Pathol 13174 1 Synovial sarcoma Adrenal t(X;18)(p11;q11) SS18/SSX
Kadkol et al 2006 Cancer Genet Cytogenet 11524 1 Acute myelomonocytic leukemia (FAB type M4) ins(11;X)(q23;q24q22) MLL/SEPT6
Kagan et al 1987 Proc Natl Acad Sci U S A 2136 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;14)(q24;q11) TRA@+
Kagan et al 1989 Proc Natl Acad Sci U S A 3037 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;14)(q24;q11) TRD@/TLX1
Kagan et al 1989 Proc Natl Acad Sci U S A 3037 3 Mature T- and NK-cell neoplasm, NOS t(10;14)(q24;q11) TRD@/TLX1
Kagan et al 1990 Cancer Res 3587 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;14)(q24;q11) TRD@/TLX1
Kakazu et al 2001 Int J Hematol 9452 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;20)(p15;q11) NUP98+
Kakihana et al 2008 Cancer Genet Cytogenet 12516 1 Chronic myelomonocytic leukemia t(11;19)(q23;p13) MLL/ELL
Kalla et al 2000 Leukemia 9001 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;18)(q22;q21) BIRC3/MALT1
Kalla et al 2000 Leukemia 9001 2 Extranodal marginal zone B-cell lymphoma Lung t(11;18)(q22;q21) BIRC3/MALT1
Kalla et al 2000 Leukemia 9001 3 Extranodal marginal zone B-cell lymphoma Salivary gland t(11;18)(q22;q21) BIRC3/MALT1
Kalla et al 2000 Leukemia 9001 4 Extranodal marginal zone B-cell lymphoma Thyroid t(11;18)(q22;q21) BIRC3/MALT1
Kalla et al 2005 Genes Chromosomes Cancer 10833 1 Chronic lymphocytic leukemia t(X;11)(q21;q23) BRWD3+,ARHGAP20+
Kaltenbach et al 2010 Blood 13392 1 Acute myeloblastic leukemia without maturation (FAB type M1) inv(11)(p15q23) NUP98/MLL
Kaltenbach et al 2010 Blood 13392 2 Acute myeloblastic leukemia with maturation (FAB type M2) inv(11)(p15q23) NUP98/MLL
Kamps & Baltimore 1993 Mol Cell Biol 4702 1 Acute myeloid leukemia, NOS t(1;19)(q23;p13) TCF3/PBX1
Kamps et al 1990 Cell 3338 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;19)(q23;p13) TCF3/PBX1
Kanazawa et al 2005 Leuk Lymphoma 11367 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(16;21)(p11;q22) FUS/ERG
Kanda et al 1997 Int J Hematol 7274 1 Acute myeloid leukemia, NOS t(11;19)(q23;p13) MLL/ELL
Kandasamy et al 2007 Cancer Genet Cytogenet 12082 1 Adenoma Salivary gland t(1;4;8)(p32;q35;q12) PLAG1+
Kandasamy et al 2007 Cancer Genet Cytogenet 12082 2 Adenoma Salivary gland ins(9;8)(p22;q12q21) PLAG1+
Kaneko et al 1988 Blood 2655 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;11)(q34;p13) TRB@+
Kaneko et al 1988 Blood 2655 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;14)(q34;q11) TRA@/TRB@
Kaneko et al 1988 Blood 2655 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;14)(p14;q32) TRG@/IGH@
Kaneko et al 1996 Genes Chromosomes Cancer 6192 1 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(17;22)(q21;q12) EWSR1/ETV4
Kaneko et al 1997 Genes Chromosomes Cancer 6742 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton ins(21;22)(q22;q12q12) EWSR1/ERG
Kang et al 2005 Cancer Genet Cytogenet 10995 1 Acute myeloid leukemia, NOS t(11;17)(q23;q21) MLL+
Kang et al 2005 Cancer Genet Cytogenet 10995 2 Acute myeloid leukemia, NOS t(11;17)(q23;q25) MLL+
Kantarjian et al 1991 Blood 3976 1 Acute undifferentiated leukemia t(9;22)(q34;q11) BCR/ABL1
Karasawa et al 1996 Leuk Res 6540 1 Chronic myeloid leukemia, t(9;22) dmin +MYC
Karenko et al 2005 Cancer Res 11236 1 Mycosis fungoides/Sezary syndrome t(12;18)(q21;q21) NAV3+
Karrman et al 2006 Eur J Haematol 11571 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;14)(p13;q11) CCND2+
Karrman et al 2009 Br J Haematol 12691 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(X;7)(q22;q34) TRB@/IRS4
Kas et al 1997 Nat Genet 6727 1 Adenoma Salivary gland t(3;8)(p22;q12) CTNNB1/PLAG1
Kas et al 1997 Nat Genet 6727 2 Adenoma Salivary gland ins(8;3)(q12;p22p14) CTNNB1/PLAG1
Kas et al 1997 Nat Genet 6727 3 Adenoma Salivary gland t(8;15)(q12;q14) PLAG1+
Kasai et al 1992 Mol Cell Biol 4504 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRD@/PVT1
Kato et al 2009 Int J Hematol 12864 1 Acute promyelocytic leukemia (FAB type M3) t(15;22;17)(q22;q11;q21) PML/RARA
Katoh & Katoh 2004 Int J Oncol 13447 1 Myelodysplastic syndrome, NOS t(2;8)(p23;p11) MYST3/ASXL2
Katsura et al 2007 Cancer Genet Cytogenet 12108 1 Refractory anemia with excess blasts-2 t(5;12)(q31;p13) ETV6/ACSL6
Kaune et al 2009 Arch Dermatol 12959 1 Extranodal marginal zone B-cell lymphoma Skin t(8;22)(q24;q11) IGL@/MYC
Kawakami et al 1998 Int J Hematol 7643 1 Diffuse large B-cell lymphoma t(9;14)(p13;q32) IGH@/PAX5
Kawakami et al 2004 Int J Hematol 10865 2 Mature B-cell neoplasm, NOS t(11;22)(q13;q11) IGL@/CCND1
Kawakubo et al 1993 Leukemia 4921 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(7;12)(q34;q24) TRB@+
Kawamata et al 2002 Oncogene 9747 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(q25;q32) IGH@/LHX4
Kawamata et al 2008 Proc Natl Acad Sci U S A 13225 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma dic(9;20)(p13;q11) PAX5/C20ORF112
Kawamata et al 2008 Proc Natl Acad Sci U S A 13225 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;9)(q11;p13) PAX5/AUTS2
Kawamata et al 2008 Proc Natl Acad Sci U S A 13225 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;9)(p13;p13) PAX5/FOXP1
Kawamura-Saito et al 2006 Hum Mol Genet 11579 1 Soft tissue tumor, special type Soft tissue t(4;19)(q35;q13) CIC/DUX4
Kawauchi et al 1998 Am J Surg Pathol 7873 1 Ewing tumor/peripheral primitive neuroectodermal tumor Ovary t(11;22)(q24;q12) EWSR1/FLI1
Kazakov et al 2009 Am J Dermatopathol 12837 1 Malignant epithelial tumor, special type Skin t(11;19)(q21;p13) CRTC1/MAML2
Kazmierczak et al 1996 Genomics 6627 1 Leiomyoma Uterus, corpus der(12)(q14) HMGA2+
Kazmierczak et al 1996 Genes Chromosomes Cancer 6688 1 Leiomyoma Uterus, corpus t(6;14)(p21;q11) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 1 Chondroid hamartoma Lung t(6;14)(p21;q24) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 2 Chondroid hamartoma Lung t(4;6)(q35;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 3 Chondroid hamartoma Lung t(6;8)(p21;q12-13) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 4 Chondroid hamartoma Lung t(6;10)(p21;q22) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 5 Chondroid hamartoma Lung t(6;16)(p21;q24) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 6 Leiomyoma Uterus, corpus t(2;14;6)(p13;q24;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 7 Chondroid hamartoma Lung t(3;6)(p25-26;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 8 Chondroid hamartoma Lung t(6;12)(p21;q22) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 9 Adenoma Uterus, corpus t(6;20)(p21;q13) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 10 Adenoma Uterus, corpus t(2;6)(q35;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 11 Adenoma Uterus, corpus t(6;10)(p21;q22) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 12 Adenoma Uterus, corpus inv(6)(p21q21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 13 Adenoma Uterus, corpus t(6;8)(p21;q12) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 14 Adenoma Uterus, corpus add(6)(p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 15 Adenoma Uterus, corpus t(5;6;14)(q35;p21;q?) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 16 Adenoma Uterus, corpus t(1;6)(p32;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 17 Adenoma Uterus, corpus t(6;7)(p21;p15) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 18 Adenoma Uterus, corpus t(6;15)(p21;q21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 19 Adenoma Uterus, corpus t(2;6)(p22;p21) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 20 Adenoma Uterus, corpus inv(6)(p21q23) HMGA1+
Kazmierczak et al 1998 Genes Chromosomes Cancer 7700 21 Lipoma Unknown site t(3;6)(q28;p21) HMGA1+
Kazmierczak et al 1998 Am J Pathol 7752 1 Lipoma Soft tissue ins(12;12)(p11;q14q14) HMGA2+
Kazmierczak et al 1998 Am J Pathol 7752 2 Lipoma Soft tissue inv(12)(q14q24) HMGA2+
Kazmierczak et al 1998 Am J Pathol 7752 3 Lipoma Soft tissue inv(12)(p11q14) HMGA2+
Kazmierczak et al 1998 Am J Pathol 7752 4 Chondroid hamartoma Lung inv(12)(p11q14) HMGA2+
Kazmierczak et al 1998 Am J Pathol 7752 5 Myxoma Soft tissue inv(12)(p11q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 1 Chondroid hamartoma Lung t(6;14)(p21;q24) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 2 Chondroid hamartoma Lung inv(12)(q14q22) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 3 Chondroid hamartoma Lung t(12;16)(q14;q21) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 4 Chondroid hamartoma Lung t(6;12)(q25;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 5 Chondroid hamartoma Lung inv(12)(p12q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 6 Chondroid hamartoma Lung t(12;14)(q14;q24) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 7 Chondroid hamartoma Lung der(12)(q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 8 Chondroid hamartoma Lung ins(12;8)(q14;p22p23) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 9 Chondroid hamartoma Lung ins(12;3)(q14;q13q29) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 10 Chondroid hamartoma Lung t(11;12)(p15;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 11 Chondroid hamartoma Lung ins(1;12)(p22;q24q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 12 Chondroid hamartoma Lung del(12)(q14q23) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 13 Chondroid hamartoma Lung der(12)inv(12)(p11q14)inv(12)(q14p13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 14 Chondroid hamartoma Lung t(6;14;8)(p21;q24;q24) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 15 Chondroid hamartoma Lung inv(12)(q14q?) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 16 Chondroid hamartoma Lung t(2;12)(q33;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 17 Chondroid hamartoma Lung t(11;12)(q14;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 18 Chondroid hamartoma Lung ins(12;12)(q14;q13q15) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 19 Chondroid hamartoma Lung t(3;12)(q27;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 20 Chondroid hamartoma Lung t(6;10)(p21;q22) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 21 Chondroid hamartoma Lung t(12;12;16)(p12;q14;p12-13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 22 Chondroid hamartoma Lung t(12;18)(q14;q21) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 23 Chondroid hamartoma Lung ins(4;6)(q35;p21p25) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 24 Chondroid hamartoma Lung t(6;14)(p21;q24) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 25 Chondroid hamartoma Lung inv(12)(p13q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 26 Chondroid hamartoma Lung inv(12)(q13q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 27 Chondroid hamartoma Lung del(12)(q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 28 Chondroid hamartoma Lung t(4;12)(q35;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 29 Chondroid hamartoma Lung t(6;6)(p21;q26) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 30 Chondroid hamartoma Lung add(12)(q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 31 Chondroid hamartoma Lung del(6)(p21) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 32 Chondroid hamartoma Lung t(3;12)(q?;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 33 Chondroid hamartoma Lung t(3;12)(q29;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 34 Chondroid hamartoma Lung t(6;10)(p21;q26) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 35 Chondroid hamartoma Lung t(3;12)(q25;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 36 Chondroid hamartoma Lung t(11;12)(q23;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 37 Chondroid hamartoma Lung t(12;17)(q14;p13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 38 Chondroid hamartoma Lung ins(12;1)(q14;p23p13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 39 Chondroid hamartoma Lung t(7;12)(p22;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 40 Chondroid hamartoma Lung ins(12)(p13q13q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 41 Chondroid hamartoma Lung t(9;12)(p23;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 42 Chondroid hamartoma Lung t(4;12)(q12;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 43 Chondroid hamartoma Lung t(6;12)(p21;q22) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 44 Chondroid hamartoma Lung inv(12)(p12q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 45 Chondroid hamartoma Lung ins(12;10)(q14;q11q26) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 46 Chondroid hamartoma Lung inv(12)(?q14q24) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 47 Chondroid hamartoma Lung del(12)(q14q21) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 48 Chondroid hamartoma Lung t(3;12)(q27-28;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 49 Chondroid hamartoma Lung t(6;12)(q22;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 50 Chondroid hamartoma Lung add(6)(p21) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 51 Chondroid hamartoma Lung ins(X;12)(p22;q13q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 52 Chondroid hamartoma Lung t(X;12)(q26;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 53 Chondroid hamartoma Lung t(12;13)(q14;q13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 54 Chondroid hamartoma Lung ins(12;?)(q14;?) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 55 Chondroid hamartoma Lung t(5;12)(q31;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 56 Chondroid hamartoma Lung inv(12)(q14q22) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 57 Chondroid hamartoma Lung t(1;6;4)(p36;p21;q12) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 58 Chondroid hamartoma Lung t(5;12)(q34;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 59 Chondroid hamartoma Lung del(12)(q13q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 60 Chondroid hamartoma Lung t(5;6;14)(q22;p21;q24) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 61 Chondroid hamartoma Lung ins(16;12)(p13;q24q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 62 Chondroid hamartoma Lung ins(14;12)(q24;q14q24) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 63 Chondroid hamartoma Lung t(7;12;19)(p14;q14;q13) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 64 Chondroid hamartoma Lung t(4;12)(p14;q14) HMGA2+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 65 Chondroid hamartoma Lung t(6;10)(p21;q11-21) HMGA1+
Kazmierczak et al 1999 Genes Chromosomes Cancer 8134 66 Chondroid hamartoma Lung t(1;6)(p33;p21) HMGA1+
Kazmierczak et al 1999 Cancer Genet Cytogenet 8149 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Soft tissue add(12)(q14) HMGA2+
Kearney et al 2001 Leuk Res 9054 1 Myelodysplastic syndrome, NOS t(9;22)(q34;q11) BCR/ABL1
Kees et al 1989 Blood 3123 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;10)(q34;q24) TRB@+
Kelly et al 1996 Cancer 6716 1 Alveolar rhabdomyosarcoma Soft tissue t(1;13)(p36;q14) PAX7/FOXO1
Kelly et al 2009 Cancer Genet Cytogenet 12722 1 Acute myeloid leukemia, NOS t(4;21;8)(q25;q22;q22) RUNX1/RUNX1T1
Kelly et al 2009 Cancer Genet Cytogenet 12885 1 Atypical chronic myeloid leukemia ins(12;9)(p13;q34q34) ETV6/ABL1
Kennedy et al 1991 Proc Natl Acad Sci U S A 4082 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(7;10)(q34;q24) TRB@/TLX1
Kerckaert et al 1993 Nat Genet 5261 1 Mature B-cell neoplasm, NOS t(3;4)(q27;p11) BCL6+
Kerim et al 1990 Br J Haematol 3520 1 Chronic myeloid leukemia, aberrant translocation t(1;3;9;22)(p12;q22;q34;q11) BCR+
Keung et al 2002 Cancer Genet Cytogenet 9842 1 Atypical chronic myeloid leukemia t(9;12)(q34;p13) ETV6/ABL1
Kikuchi et al 1993 Leukemia 4993 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(1)(p33) TAL1+
Kikuchi et al 1999 J Pediatr Hematol Oncol 8449 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(5;8;21)(q33;q22;q22) RUNX1/RUNX1T1
Kim et al 2000 Am J Surg Pathol 8785 1 Synovial sarcoma Kidney t(X;18)(p11;q11) SS18/SSX2
Kim et al 2002 Br J Haematol 9935 1 Acute monoblastic leukemia without differentiation (FAB type M5a) add(11)(q23) MLL+
Kim et al 2002 Br J Haematol 9935 2 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(q22;q23) MLL+
Kim et al 2002 Br J Haematol 9935 5 Acute monoblastic leukemia without differentiation (FAB type M5a) t(1;11)(p32;q23) MLL+
Kim et al 2002 Br J Haematol 9935 6 Acute myelomonocytic leukemia (FAB type M4) t(11;17)(q23;q21) MLL+
Kim et al 2002 Br J Haematol 9935 7 Acute monoblastic leukemia without differentiation (FAB type M5a) t(2;11)(p21;q23) MLL+
Kim et al 2002 Br J Haematol 9935 8 Acute myeloblastic leukemia without maturation (FAB type M1) t(11;19)(q23;p13) MLL+
Kim et al 2003 Genes Chromosomes Cancer 10129 1 Acute monoblastic leukemia with differentiation (FAB type M5b) ins(X;11)(q24;q23q13) MLL/SEPT6
Kim et al 2006 Cancer Genet Cytogenet 11544 1 Acute myeloid leukemia, NOS t(15;19;17)(q22;p13;q21) PML/RARA
Kitabayashi et al 2001 Leukemia 9082 1 Acute myeloid leukemia, NOS t(8;22)(p11;q13) MYST3/EP300
Kitazawa et al 1998 Int J Hematol 7642 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(9;11)(p21;q23) MLL+
Klaus et al 2003 Cancer Genet Cytogenet 10172 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(10;11)(p12;q23) MLL/MLLT10
Klaus et al 2003 Cancer Genet Cytogenet 10172 2 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(11;10)(q23;p12p12) MLL/MLLT10
Klaus et al 2003 Cancer Genet Cytogenet 10172 3 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(10;11)(p12;q25q23) MLL/MLLT10
Klein et al 1990 J Exp Med 5037 1 Chronic myeloid leukemia, t(9;22) idic(17)(q21) CSF3+
Klugbauer & Rabes 1999 Oncogene 9697 1 Adenocarcinoma Thyroid t(7;10)(q34;q11) TRIM24/RET
Klugbauer & Rabes 1999 Oncogene 9697 2 Adenocarcinoma Thyroid t(1;10)(p13;q11) TRIM33/RET
Klugbauer et al 1998 Cancer Res 9696 1 Adenocarcinoma Thyroid t(10;14)(q11;q32) GOLGA5/RET
Klugbauer et al 2000 Cancer Res 8927 1 Adenocarcinoma Thyroid t(10;18)(q11;q11-23) RFG9/RET
Knezevich et al 1998 Nat Genet 7154 1 Fibrosarcoma/sclerosing epithelioid fibrosarcoma Soft tissue t(12;15)(p13;q25) ETV6/NTRK3
Knezevich et al 1998 Cancer Res 7864 1 Mesoblastic nephroma Kidney t(12;15)(p13;q25) ETV6/NTRK3
Knezevich et al 2005 Leukemia 10939 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14;18)(q24;q32;q21) IGH@/MYC,IGH@/BCL2
Knezevich et al 2005 Leukemia 10939 2 Follicular lymphoma t(8;14;18)(q24;q32;q21) IGH@/MYC,IGH@/BCL2
Knutsen et al 2006 Cancer Genet Cytogenet 11343 1 Plasma cell leukemia t(11;14)(q13;q32) IGH@/CCND1
Ko et al 2002 Am J Hematol 9950 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;9;22)(?;q34;q11) BCR/ABL1
Kobayashi et al 1993 Blood 4933 1 Acute myeloid leukemia, NOS t(6;11)(q27;q23) MLL+
Kobayashi et al 1993 Blood 4933 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;11)(p21;q23) MLL+
Kobayashi et al 1993 Blood 4933 3 Acute myelomonocytic leukemia (FAB type M4) t(11;19)(q23;p13) MLL+
Kobayashi et al 1993 Blood 4933 4 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(p11;q23) MLL+
Kobayashi et al 1993 Blood 4933 5 Acute monoblastic leukemia (FAB type M5) ins(10;11)(p11;q13q23) MLL+
Kobayashi et al 1993 Blood 4933 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;11)(q27;q23) MLL+
Kobayashi et al 1996 Br J Haematol 6530 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(12)(p13) ETV6+
Kobayashi et al 1996 Br J Haematol 6530 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma del(12)(p13) ETV6+
Kobayashi et al 1996 Br J Haematol 6530 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(12)(p13) ETV6+
Kobayashi et al 1996 Br J Haematol 6530 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(3;12)(p21;p13) ETV6+
Kobayashi et al 1996 Br J Haematol 6530 7 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(?2;12)(?q11;p13) ETV6+
Kobayashi et al 1997 Genes Chromosomes Cancer 7177 1 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12;q14) PICALM/MLLT10
Kobayashi et al 1997 Genes Chromosomes Cancer 7177 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(p12;q14) PICALM/MLLT10
Kobayashi et al 1997 Genes Chromosomes Cancer 7177 4 Acute myeloid leukemia, NOS t(10;11)(p12;q14) PICALM/MLLT10
Kobayashi et al 2001 Diagn Mol Pathol 9600 1 Waldenstrom macroglobulinemia t(11;18)(q22;q21) BIRC3/MALT1
Kobayashi et al 2001 Diagn Mol Pathol 9600 3 Extranodal marginal zone B-cell lymphoma Thyroid t(11;18)(q22;q21) BIRC3/MALT1
Kobayashi et al 2001 Diagn Mol Pathol 9600 4 Extranodal marginal zone B-cell lymphoma Eye t(11;18)(q22;q21) BIRC3/MALT1
Kobzev et al 2004 Genes Chromosomes Cancer 10780 1 Chronic myeloid leukemia, t(9;22) t(1;11)(q24;p15) NUP98/PRRX1
Kobzev et al 2004 Genes Chromosomes Cancer 10780 2 Acute myeloid leukemia, NOS t(1;11)(q24;p15) NUP98/PRRX1
Kobzev et al 2004 Genes Chromosomes Cancer 10780 3 Chronic myeloid leukemia, t(9;22) t(2;11)(q31;p15) NUP98/HOXD13
Kobzev et al 2004 Genes Chromosomes Cancer 10780 4 Acute monoblastic leukemia (FAB type M5) t(11;20)(p15;q12) NUP98/TOP1
Kobzev et al 2004 Genes Chromosomes Cancer 10780 5 Acute megakaryoblastic leukemia (FAB type M7) t(11;17)(p15;q23) NUP98+
Koduru & Offit 1991 Oncogene 3732 1 Diffuse large B-cell lymphoma t(8;22)(q24;q11) IGL@/MYC
Koduru & Offit 1991 Oncogene 3732 2 Mature B-cell neoplasm, NOS t(18;22)(q21;q11) IGL@/BCL2
Koduru & Offit 1991 Oncogene 3732 3 Mature B-cell neoplasm, NOS t(8;14)(q24;q32) IGH@/MYC
Koduru et al 1989 Oncogene 3175 1 Mantle cell lymphoma t(11;14)(q13;q32) IGH@/CCND1
Koduru et al 1989 Oncogene 3175 2 Mantle cell lymphoma t(1;11;14)(q32;q13;q32) IGH@/CCND1
Koduru et al 1993 Oncogene 5271 1 Chronic myeloid leukemia, aberrant translocation t(9;22;11)(q34;q11;q13) BCR+,GSTP1+
Kohler et al 1990 Leukemia 3522 1 Chronic myeloid leukemia, aberrant translocation ins(22;9)(q11;q34q34) BCR/ABL1
Koivunen et al 2008 Clin Cancer Res 12745 1 Adenocarcinoma Lung inv(2)(p21p23) EML4/ALK
Kojima et al 1999 Br J Haematol 8423 1 Chronic myeloid leukemia, t(9;22) t(8;21)(q22;q22) RUNX1/RUNX1T1
Kojima et al 2003 Br J Haematol 10005 1 Myelodysplastic syndrome, NOS t(10;16)(q22;p13) MYST4/CREBBP
Kojima et al 2004 Leukemia 10553 1 Chronic neutrophilic leukemia t(4;11)(q21;q23) MLL/SEPT11
Komatsu et al 1994 Blood 5725 1 Mantle cell lymphoma t(11;22)(q13;q11) IGL@/CCND1
Kondo et al 2008 Haematologica 12668 1 Acute promyelocytic leukemia (FAB type M3) t(4;17)(q12;q21) FIP1L1/RARA
Kong et al 1997 Blood 7070 1 Acute myelomonocytic leukemia (FAB type M4) t(16;21)(p11;q22) FUS/ERG
Kong et al 1997 Blood 7070 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(16;21)(p11;q22) FUS/ERG
Kong et al 1997 Blood 7070 3 Acute monoblastic leukemia with differentiation (FAB type M5b) t(16;21)(p11;q22) FUS/ERG
Kong et al 1997 Blood 7070 4 Acute megakaryoblastic leukemia (FAB type M7) t(16;21)(p11;q22) FUS/ERG
Kong et al 2004 Cancer Genet Cytogenet 10720 1 Anaplastic large cell lymphoma, systemic type t(2;5;13)(p23;q35;q14) ALK+
Konig et al 2002 Br J Haematol 9546 1 Acute myeloid leukemia, NOS t(4;11)(q21;q23) MLL/AFF1
Konig et al 2002 Br J Haematol 9546 2 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(4;11)(q21;q23) MLL/AFF1
Koontz et al 2001 Proc Natl Acad Sci U S A 9086 1 Endometrial stromal sarcoma Uterus, corpus t(7;17)(p15;q11) JAZF1/SUZ12
Kourlas et al 2000 Proc Natl Acad Sci U S A 8650 1 Acute myelomonocytic leukemia (FAB type M4) del(11)(q23q23) MLL/ARHGEF12
Kowarz et al 2007 Leukemia 11986 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;4;11)(q23;q21;q23) PBX1/MLL,AFF1/PBX1,MLL/AFF1
Kowarz et al 2007 Leukemia 11986 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(11;4)(q23;q21q24) MLL/AFF1,NFKB1/MLL
Kowarz et al 2007 Leukemia 11986 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(4;11)(q21;q23q23) AFF1/FXYD6,MLL/AFF1,FXYD6/MLL
Kowarz et al 2007 Leukemia 11986 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(11;4)(q23;q21q31) MLL/AFF1,ELF2/MLL,AFF1/ELF2
Kowarz et al 2007 Leukemia 11986 5 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(4;11)(q21;q23q23) AFF1/DSCAML1,MLL/AFF1,DSCAML1/MLL
Kowarz et al 2007 Leukemia 11986 6 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;4;11)(q25;q21;q23) RABGAP1L/MLL,AFF1/RABGAP1L,MLL/AFF1
Kozu et al 1993 Blood 4988 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;21)(q22;q22) RUNX1/RUNX1T1
Kramer et al 1991 Leukemia 3956 2 Burkitt lymphoma/leukemia t(14;18)(q32;q21) IGH@/BCL2
Krauter et al 1998 Br J Haematol 7974 1 Acute myeloid leukemia, NOS t(15;17)(q22;q21) PML/RARA
Kroll et al 2000 Science 8588 1 Adenocarcinoma Thyroid t(2;3)(q13;p25) PAX8/PPARG
Kubota & Waki 2010 Cancer Genet Cytogenet 13306 1 Chronic myeloid leukemia, aberrant translocation t(6;13;9;22)(p21;q32;q34;q11) BCR/ABL1
Kuchenbauer et al 2005 Leukemia 11288 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(4;12)(q12;p13) CHIC2/ETV6
Kudva et al 2004 Am J Hematol 10799 1 Acute promyelocytic leukemia (FAB type M3) t(15;17;16)(q22;q21;q13) PML/RARA
Kuefer et al 2003 Oncogene 10001 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;15)(q23;q15) MLL/CASC5
Kuiper et al 2003 Hum Mol Genet 10148 1 Adenocarcinoma Kidney t(6;11)(p21;q13) MALAT1/TFEB
Kulkarni et al 2000 Cancer Res 8774 1 Chronic myeloproliferative disorder, NOS t(5;10)(q32;q21) CCDC6/PDGFRB
Kumar et al 1999 Hum Pathol 8086 1 Ewing tumor/peripheral primitive neuroectodermal tumor Lung t(11;22)(q24;q12) EWSR1/FLI1
Kumon et al 1999 Genes Chromosomes Cancer 7950 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(p12;q14) PICALM/MLLT10
Kumon et al 1999 Genes Chromosomes Cancer 7950 3 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) t(10;11)(p12;q14) PICALM/MLLT10
Kumon et al 1999 Genes Chromosomes Cancer 7950 4 Acute monoblastic leukemia (FAB type M5) t(10;11)(p12;q14) PICALM/MLLT10
Kuno et al 1999 Br J Haematol 9095 1 Acute myeloid leukemia, NOS t(9;12)(q22;p13) ETV6+
Kuno et al 2001 Blood 8926 1 Myelodysplastic syndrome, NOS t(9;12)(q22;p13) ETV6/SYK
Kuppers et al 2002 Leukemia 11080 1 Chronic lymphocytic leukemia t(2;14)(p16;q32) IGH@/BCL11A
Kurata et al 2002 Cancer Res 9914 1 Follicular lymphoma t(3;6)(q27;p22) HIST1H4I/BCL6
Kurata et al 2002 Cancer Res 9914 2 Diffuse large B-cell lymphoma t(3;6)(q27;p22) HIST1H4I/BCL6
Kuriakose et al 2004 Cancer Genet Cytogenet 10595 1 B-prolymphocytic leukemia t(8;14)(q24;q32) IGH@/MYC
Kurose et al 2000 Genes Chromosomes Cancer 8397 1 Leiomyoma Uterus, corpus t(8;12)(q22;q14) HMGA2/COX6C
Kurosu et al 2008 Int J Hematol 12672 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;17)(q23;q25) MLL/SEPT9
Kurzrock et al 1987 Blood 2249 1 Acute myelomonocytic leukemia (FAB type M4) t(9;22)(q34;q11) ABL1+
Kusakabe et al 2008 Eur J Haematol 12393 1 Acute promyelocytic leukemia (FAB type M3) t(17;17)(q21;q21) STAT5B/RARA
Kusec et al 1994 Leukemia 5470 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(8;21)(q22;q22) RUNX1/RUNX1T1
Kuwada et al 2001 Cancer Res 9056 1 Acute monoblastic leukemia (FAB type M5) t(11;14)(q23;q23) MLL/GPHN
Kwon et al 2004 Cancer Genet Cytogenet 10771 1 Chronic myeloid leukemia, aberrant translocation t(7;9;22)(p22;q34;q11) BCR/ABL1
Kwong & Pang 1999 Genes Chromosomes Cancer 7949 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(7;11)(p15;p15) NUP98/HOXA9
Kwong et al 1996 Cancer Genet Cytogenet 6345 1 Acute erythroleukemia (FAB type M6) der(11)(q23) MLL+
La Starza et al 1996 J Pathol 6565 1 Mature B-cell neoplasm, NOS add(14)(q32) IGH@+
La Starza et al 1997 Cancer Genet Cytogenet 6922 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;14;21)(q22-24;q11;q22) RUNX1/RUNX1T1
La Starza et al 1998 Genes Chromosomes Cancer 7584 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(16;20)(p13;q11) MYH11+
La Starza et al 2002 Haematologica 9583 1 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(p21;q34;q11) BCR/ABL1
La Starza et al 2002 Haematologica 9583 2 Chronic myeloid leukemia, aberrant translocation t(6;9;22)(p24;q34;q11) BCR/ABL1
La Starza et al 2002 Haematologica 9906 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(9;12)(q34;p13) ETV6/ABL1
La Starza et al 2002 Haematologica 9906 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(9;12)(q34;p13) ETV6/ABL1
La Starza et al 2003 Genes Chromosomes Cancer 9976 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;12)(p15;q13) NUP98/HOXC13
La Starza et al 2004 Genes Chromosomes Cancer 10779 1 Refractory anemia with excess blasts-1 ins(5;11)(q35;p15p1?) NUP98/NSD1
La Starza et al 2005 Leukemia 11694 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;19)(p13;p13) TCF3/ZNF384
La Starza et al 2006 Haematologica 11683 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(10;19;11)(p12;p13;q14) PICALM/MLLT10
La Starza et al 2007 Leukemia 12125 1 Chronic myelomonocytic leukemia t(5;16)(q32;p13) NDE1/PDGFRB
Laabi et al 1992 EMBO J 4503 1 Mature T- and NK-cell neoplasm, NOS t(4;16)(q27;p13) IL2/TNFRSF17
Labelle et al 1995 Hum Mol Genet 6128 1 Chondrosarcoma, myxoid Soft tissue t(9;22)(q31;q12) EWSR1/NR4A3
Lacronique et al 1997 Science 7197 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(9;12)(p24;p13) ETV6/JAK2
Laczika et al 1998 J Clin Oncol 7567 1 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) inv(16)(p13q22) CBFB/MYH11
Laczika et al 1998 J Clin Oncol 7567 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(16;16)(p13;q22) CBFB/MYH11
Ladanyi & Gerald 1994 Cancer Res 5405 1 Desmoplastic small round cell tumor Intraabdominal t(11;22)(p13;q12) EWSR1/WT1
Ladanyi & Gerald 1994 Cancer Res 5405 2 Desmoplastic small round cell tumor Intrathoracal t(11;22)(p13;q12) EWSR1/WT1
Ladanyi & Gerald 1994 Cancer Res 5405 3 Desmoplastic small round cell tumor Soft tissue t(11;22)(p13;q12) EWSR1/WT1
Ladanyi et al 1991 Blood 3729 1 Anaplastic large cell lymphoma, systemic type del(8)(q24) MYC+
Ladanyi et al 1991 Blood 3729 2 Diffuse large B-cell lymphoma t(7;8;14)(p15;q24;q32) MYC+
Ladanyi et al 1993 Diagn Mol Pathol 5089 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton t(11;22)(q24;q12) EWSR1+
Ladanyi et al 1993 Diagn Mol Pathol 5089 2 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(11;22)(q24;q12) EWSR1+
Ladanyi et al 2001 Oncogene 9080 1 Alveolar soft part sarcoma Soft tissue t(X;17)(p11;q25) ASPSCR1/TFE3
Lahortiga et al 2003 Cancer Res 10235 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(10;11)(q25;p15) NUP98/ADD3
Lahortiga et al 2005 Cancer Genet Cytogenet 10887 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(7;11;13;17)(p15;p15;p?;p1?2) NUP98/HOXA9
Lahortiga et al 2008 Haematologica 12398 1 Mastocytosis t(4;5)(q21;q32) PRKG2/PDGFRB
Lai et al 1998 Cancer Genet Cytogenet 7457 1 Diffuse large B-cell lymphoma t(3;13)(q27;q14) BCL6+
Lai et al 1998 Cancer Genet Cytogenet 7457 2 Follicular lymphoma t(3;13)(q27;q14) BCL6+
Lamant et al 1999 Blood 8080 1 Anaplastic large cell lymphoma, systemic type t(1;2)(q21;p23) TPM3/ALK
Lamant et al 2003 Genes Chromosomes Cancer 10169 1 Anaplastic large cell lymphoma, systemic type t(2;22)(p23;q12) MYH9/ALK
Lane et al 2007 J Urol 12828 1 Adenocarcinoma Prostate t(4;6)(q22;q15) UNC5C+
Langabeer et al 1997 Br J Haematol 6987 1 Acute myeloblastic leukemia with maturation (FAB type M2) inv(16)(p13q22) CBFB/MYH11
Langabeer et al 1997 Br J Haematol 7389 1 Acute myelomonocytic leukemia (FAB type M4) t(8;21)(q22;q22) RUNX1/RUNX1T1
Langabeer et al 1997 Br J Haematol 7389 2 Acute monoblastic leukemia (FAB type M5) t(8;21)(q22;q22) RUNX1/RUNX1T1
Langabeer et al 1998 Br J Haematol 7621 1 Acute myeloid leukemia, NOS t(15;17)(q22;q21) PML/RARA
Lasota et al 1998 Mod Pathol 7812 1 Synovial sarcoma Soft tissue ins(X;18)(p11;q11q21) SS18/SSX1
Lau et al 1998 Cancer Genet Cytogenet 7489 1 Chronic myeloid leukemia, aberrant translocation t(9;22;10;12;1)(q34;q11;q22;p12;p36) BCR/ABL1
Lau et al 2005 Cancer Genet Cytogenet 11224 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(8;14;21)(q22;q32;q22) RUNX1/RUNX1T1
Lavau et al 1997 EMBO J 7173 1 Acute myeloid leukemia, NOS t(11;19)(q23;p13) MLL/MLLT1
Lawrence et al 2000 Am J Pathol 10798 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intrathoracal t(1;2)(q21;p23) TPM3/ALK
Lawrence et al 2000 Am J Pathol 10798 2 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intraabdominal t(2;19)(p23;p13) TPM4/ALK
Lawrence et al 2000 Am J Pathol 10798 3 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intraabdominal t(1;2)(q21;p23) TPM3/ALK
Laxman et al 2006 Neoplasia 11735 1 Adenocarcinoma Prostate t(21;21)(q22;q22) TMPRSS2/ERG
Le Beau et al 1986 Proc Natl Acad Sci U S A 2122 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p15;q11) TRA@+
Le Coniat et al 1994 C R Acad Sci 5541 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(9;11)(q33;q23) MLL+
Leblanc et al 1994 Leukemia 5661 1 Acute monoblastic leukemia with differentiation (FAB type M5b) t(11;11)(q13;q23) MLL+
Leblanc et al 1996 Leukemia 6733 1 Acute myeloblastic leukemia with maturation (FAB type M2) del(11)(q23q23) MLL+
Leblanc et al 1997 Genes Chromosomes Cancer 6948 1 Diffuse large B-cell lymphoma der(9)(p21) CDKN2A+
Lecointe et al 1999 Oncogene 8213 1 Mature B-cell neoplasm, NOS t(11;14)(q23;q32) IGH@/PAFAH1B2
Lee et al 1987 Blood 2146 1 Diffuse large B-cell lymphoma t(14;18)(q32;q21) BCL2+
Lee et al 1987 Blood 2146 2 Mature B-cell neoplasm, NOS der(18)(q21) BCL2+
Lee et al 1997 Nat Genet 7263 1 Desmoplastic small round cell tumor Unknown site t(11;22)(p13;q12) EWSR1/WT1
Lee et al 2004 Int J Mol Med 10537 1 Acute myeloblastic leukemia without maturation (FAB type M1) hsr +MLL
Lee et al 2005 Cancer Genet Cytogenet 10831 1 Acute myeloid leukemia, NOS t(8;10;21)(q22;q24;q22) RUNX1/RUNX1T1
Lee et al 2005 Cancer Genet Cytogenet 10993 1 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue ins(22;21)(q12;q21q22) EWSR1+
Lee et al 2009 Cancer Genet Cytogenet 12916 1 Acute myeloblastic leukemia with maturation (FAB type M2) hsr(4)(q25) +MYC
Lee et al 2009 Cancer Genet Cytogenet 12916 2 Acute myeloblastic leukemia with maturation (FAB type M2) dmin +MYC
Lee et al 2010 Cancer Genet Cytogenet 13107 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;19;11)(p12;p13;q23) MLL/MLLT1
Leich et al 2007 J Pathol 12181 1 Angioimmunoblastic T-cell lymphoma inv(14)(q11q32) IGH@/TRA@
Lekanne Deprez et al 1995 Oncogene 5972 1 Meningioma Brain t(4;22)(p16;q12) MN1+
Lemke et al 2001 Cytogenet Cell Genet 9659 1 Lipoma Soft tissue t(3;12)(q28;q14) LPP/C12ORF9
Lennerz et al 2009 Am J Surg Pathol 12895 1 Mucoepidermoid carcinoma Uterus, cervix t(11;19)(q21;p13) CRTC1/MAML2
Lennon et al 2007 Cancer Genet Cytogenet 12081 1 Acute myeloid leukemia, NOS t(3;8)(q26;q24) EVI1+
Lens et al 1999 Leukemia 8066 1 B-prolymphocytic leukemia t(2;8)(p11;q24) IGK@/MYC
Lenz et al 2007 J Exp Med 12050 1 Diffuse large B-cell lymphoma t(14;19)(q32;q13) IGH@/SPIB
Leroux et al 1990 Leukemia 3617 1 Diffuse large B-cell lymphoma t(3;22)(q28;q11) IGL@+
Lese et al 1995 Genes Chromosomes Cancer 5851 1 Squamous cell carcinoma Oral cavity hsr +FGF3,+FGF4
Lese et al 1995 Genes Chromosomes Cancer 5851 2 Squamous cell carcinoma Tongue hsr +FGF3,+FGF4
Lese et al 1995 Genes Chromosomes Cancer 5851 3 Squamous cell carcinoma Oral cavity hsr +FGF3,+FGF4
Lese et al 1995 Genes Chromosomes Cancer 5851 4 Squamous cell carcinoma Tongue hsr +FGF3,+FGF4
Levine et al 2005 Leukemia 11161 1 Chronic myeloproliferative disorder, NOS t(5;14)(q32;q32) CCDC88C/PDGFRB
Lewis et al 1985 Nature 1951 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p13;q11) TRA@+
Li et al 2008 Science 12792 1 Nonneoplastic epithelial disorder/lesion Uterus, corpus t(7;17)(p15;q11) JAZF1/SUZ12
Liang et al 1998 Blood 7687 1 Bilineage or biphenotypic leukemia inv(8)(p11q13) MYST3/NCOA2
Liang et al 2004 Am J Clin Pathol 10608 1 Anaplastic large cell lymphoma, cutaneous type ins(8;2)(q22;p21p23) ALK+
Liang et al 2004 Am J Clin Pathol 10608 2 Anaplastic large cell lymphoma, systemic type der(2)(p23) ALK+
Liang et al 2004 Am J Clin Pathol 10608 3 Anaplastic large cell lymphoma, cutaneous type t(2;2)(q3?5;p23) ALK+
Licht et al 1995 Blood 5750 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;17)(q23;q21) ZBTB16/RARA
Licht et al 1995 Blood 5750 2 Acute promyelocytic leukemia (FAB type M3) t(11;17)(q23;q21) ZBTB16/RARA
Lillington et al 1998 Leukemia 7527 1 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(p12;q23) MLL/MLLT10
Lillington et al 1998 Leukemia 7527 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(10;11)(p12;q23) MLL/MLLT10
Limpens et al 1995 Blood 11641 1 Nonneoplastic lymphatic disorder/lesion t(14;18)(q32;q21) IGH@/BCL2
Lin et al 2008 Hum Pathol 12940 1 Follicular lymphoma t(18;22)(q21;q11) IGL@/BCL2
Lin et al 2009 Mol Cancer Res 13068 1 Adenocarcinoma Breast inv(2)(p21p23) EML4/ALK
Lin et al 2009 Mol Cancer Res 13068 2 Adenocarcinoma Large intestine inv(2)(p21p23) EML4/ALK
Liu et al 1993 Science 4943 1 Acute myelomonocytic leukemia (FAB type M4) inv(16)(p13q22) CBFB/MYH11
Liu et al 1994 Proc Natl Acad Sci U S A 11640 1 Nonneoplastic lymphatic disorder/lesion t(14;18)(q32;q21) IGH@/BCL2
Liu et al 1996 Genes Chromosomes Cancer 6422 1 Acute myeloblastic leukemia without maturation (FAB type M1) inv(16)(p13q22) CBFB/MYH11
Liu et al 1996 Genes Chromosomes Cancer 6422 2 Chronic myeloid leukemia, t(9;22) inv(16)(p13q22) CBFB/MYH11
Liu et al 1999 Oncogene 8958 1 Adenocarcinoma Breast dic(8;11)(p12;q14) ODZ4/NRG1
Liu et al 2004 Cancer Genet Cytogenet 10647 1 Chronic myelomonocytic leukemia t(5;21)(q13;q22) RUNX1+
Liu et al 2004 Cancer Genet Cytogenet 10652 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(14;14)(q11;q32) IGH@+
Liu et al 2007 Mol Cancer 12007 1 Burkitt lymphoma/leukemia t(8;14;18)(q24;q32;q21) MYC+,IGH@+,BCL2+
Llombart-Bosch et al 2000 Diagn Mol Pathol 8972 1 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue t(2;22)(q35;q12) EWSR1/FEV
Lo Coco et al 1991 Br J Haematol 4084 1 Acute promyelocytic leukemia (FAB type M3) der(17)(q21) RARA+
Lo Coco et al 1993 Cancer Res 4999 1 Bilineage or biphenotypic leukemia t(9;11)(p21;q23) MLL+
Lo Coco et al 1993 Cancer Res 4999 2 Acute myeloblastic leukemia with minimal differentiation (FAB type M0) der(11)(q23) MLL+
Lo Coco et al 1993 Cancer Res 4999 3 Acute monoblastic leukemia without differentiation (FAB type M5a) der(11)(q23) MLL+
Lo Coco et al 1993 Cancer Res 4999 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Lo Coco et al 1994 Blood 11082 2 Follicular lymphoma der(3)(q27) BCL6+
Lo Coco et al 1994 Blood 11082 3 Diffuse large B-cell lymphoma der(3)(q27) BCL6+
Longo et al 1990 J Exp Med 3738 1 Acute promyelocytic leukemia (FAB type M3) t(15;17)(q22;q21) RARA+
Lorenzen et al 1992 Hum Pathol 4663 1 Hodgkin disease, lymphocyte predominance t(14;18)(q32;q21) IGH@/BCL2
Lorenzen et al 1992 Hum Pathol 4663 2 Hodgkin disease, nodular sclerosis t(14;18)(q32;q21) IGH@/BCL2
Lorenzen et al 1992 Hum Pathol 4663 3 Hodgkin disease, mixed cellularity t(14;18)(q32;q21) IGH@/BCL2
Lorsbach et al 2003 Leukemia 10093 1 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(q21;q23) MLL/TET1
Lu et al 1991 Oncogene 4501 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma ins(2;2)(p16;p11p14) REL+
Lu et al 2002 Leukemia 9864 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(2;9)(p11;p13) PAX5+
Lu et al 2002 Leukemia 9864 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;14)(p13;q32) IGH@/ETV6
Lui et al 2008 Cancer Res 13402 1 Adenocarcinoma Thyroid t(3;7)(p25;q34) CREB3L2/PPARG
Ma et al 2000 Blood 8665 1 Anaplastic large cell lymphoma, systemic type inv(2)(p23q35) ATIC/ALK
Ma et al 2001 Nat Genet 9099 1 Acute megakaryoblastic leukemia (FAB type M7) t(1;22)(p13;q13) RBM15/MKL1
Ma et al 2003 Genes Chromosomes Cancer 10028 1 Inflammatory myofibroblastic tumor/myofibroblastic sarcoma Intraabdominal t(2;2)(p23;q13) RANBP2/ALK
MacLeod et al 2003 Genes Chromosomes Cancer 10029 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(5;14)(q35;q32) BCL11B/TLX3
Macpherson et al 1999 J Clin Oncol 8226 1 Diffuse large B-cell lymphoma t(2;8)(p12;q24) MYC+
Maes et al 1997 J Hepatol 7406 1 Extranodal marginal zone B-cell lymphoma Liver t(3;14)(q27;q32) IGH@+
Maes et al 2000 Ann Oncol 8997 1 Extranodal marginal zone B-cell lymphoma Stomach t(11;18)(q22;q21) BIRC3/MALT1
Maes et al 2001 Am J Pathol 9142 1 Anaplastic large cell lymphoma, systemic type t(2;17)(p13;q25) ALK+
Maes et al 2001 Am J Pathol 9142 2 Anaplastic large cell lymphoma, systemic type inv(2)(p23q35) ATIC/ALK
Maes et al 2001 Am J Pathol 9142 3 Hodgkin disease, NOS t(2;5)(p23;q35) NPM1/ALK
Maes et al 2001 Am J Pathol 9142 4 Hodgkin disease, NOS inv(2)(p23q35) ATIC/ALK
Magnusson et al 2001 Blood 9306 1 Chronic myelomonocytic leukemia t(5;17)(q32;p13) RABEP1/PDGFRB
Magrath et al 1983 Science 2083 1 Burkitt lymphoma/leukemia t(8;22)(q24;q11) IGL@+
Maher et al 2009 Nature 12744 1 Adenocarcinoma Prostate del(16)(q24q24) USP10/ZDHHC7
Maher et al 2009 Nature 12744 2 Adenocarcinoma Prostate t(2;2)(q37;q37) HJURP/EIF4E2
Maher et al 2009 Nature 12744 3 Adenocarcinoma Prostate t(2;2)(q11;q37) INPP4A/HJURP
Maher et al 2009 Nature 12744 4 Adenocarcinoma Prostate t(7;14)(p21;q13-21) MIPOL1/DGKB
Maher et al 2009 Nature 12744 5 Adenocarcinoma Prostate t(19;19)(p13;q13) STRN4/GPSN2
Maher et al 2009 Nature 12744 6 Adenocarcinoma Prostate t(9;9)(q32;q33) RC3H2/RGS3
Maher et al 2009 Nature 12744 7 Adenocarcinoma Prostate t(5;5)(q23;q35) LMAN2/AP3S1
Maher et al 2009 Nature 12744 8 Adenocarcinoma Prostate t(1;1)(q32;q32) SLC45A3/ELK4
Maher et al 2009 Nature 12744 9 Adenocarcinoma Prostate t(6;16)(p21;q22) MRPS10/HPR
Maher et al 2009 Nature 12744 10 Adenocarcinoma Prostate t(19;19)(q13;q13) ZNF649/ZNF577
Maher et al 2009 Nature 12744 11 Adenocarcinoma Prostate t(X;X)(p22;p22) MBTPS2/YY2
Maher et al 2009 Nature 12744 12 Adenocarcinoma Prostate t(19;19)(p13;p13) C19ORF25/APC2
Maher et al 2009 Nature 12744 13 Adenocarcinoma Prostate t(5;5)(q31;q31) WDR55/DND1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 1 Adenocarcinoma Breast t(1;17)(p13;q22) AHCYL1/RAD51C
Maher et al 2009 Proc Natl Acad Sci U S A 12995 2 Adenocarcinoma Breast t(10;22)(q24;q12) ARHGAP19/DRG1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 3 Adenocarcinoma Prostate t(7;17)(p21;p13) AX747630/ETV1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 4 Adenocarcinoma Breast t(17;17)(q22;q23) BC017255/TMEM49
Maher et al 2009 Proc Natl Acad Sci U S A 12995 5 Adenocarcinoma Prostate t(16;21)(q13;q22) HERPUD1/ERG
Maher et al 2009 Proc Natl Acad Sci U S A 12995 6 Adenocarcinoma Breast del(19)(p13p13) MYO9B/FCHO1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 7 Adenocarcinoma Breast del(14)(q32q32) PAPOLA/AK7
Maher et al 2009 Proc Natl Acad Sci U S A 12995 8 Adenocarcinoma Prostate t(2;3)(p13;q21) TIA1/DIRC2
Maher et al 2009 Proc Natl Acad Sci U S A 12995 9 Adenocarcinoma Prostate t(12;16)(q24;q24) ZDHHC7/ABCB9
Maher et al 2009 Proc Natl Acad Sci U S A 12995 10 Adenocarcinoma Prostate t(13;13)(q12;q14) DLEU2/PSPC1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 11 Adenocarcinoma Prostate del(11)(p15p15) PIK3C2A/TEAD1
Maher et al 2009 Proc Natl Acad Sci U S A 12995 12 Adenocarcinoma Prostate t(5;5)(q31;q35) SPOCK1/TBC1D9B
Maher et al 2009 Proc Natl Acad Sci U S A 12995 13 Adenocarcinoma Prostate del(1)(p36p36) RERE/PIK3CD
Mahgoub et al 1998 Genes Chromosomes Cancer 7468 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(X;11)(q22;q23) MLL+
Mahgoub et al 1998 Genes Chromosomes Cancer 7468 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma add(11)(q23) MLL+
Mahgoub et al 1998 Genes Chromosomes Cancer 7468 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Mahgoub et al 1998 Genes Chromosomes Cancer 7468 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Mairal et al 2000 Genes Chromosomes Cancer 8593 1 Retinoblastoma Eye dmin +MYCN
Maire et al 2008 Cancer Genet Cytogenet 12363 1 Ewing tumor/peripheral primitive neuroectodermal tumor Skeleton ins(22;21)(q12;q22q22) EWSR1/ERG
Maitra et al 2000 Pediatr Dev Pathol 8963 1 Malignant epithelial tumor, special type Pancreas t(11;22)(q24;q12) EWSR1/FLI1
Maitta et al 2009 Cancer Genet Cytogenet 12884 1 Acute myelomonocytic leukemia (FAB type M4) hsr(11)(q23) +MLL
Makretsov et al 2004 Genes Chromosomes Cancer 10591 1 Malignant epithelial tumor, special type Breast t(12;15)(p13;q25) ETV6/NTRK3
Malgeri et al 2000 Cancer Res 8813 1 Monoclonal gammopathy of undetermined significance t(4;14)(p16;q32) IGH@/WHSC1
Mancini et al 2000 Leukemia 8633 1 Acute monoblastic leukemia (FAB type M5) inv(16)(p13q22) CBFB/MYH11
Mancuso et al 2000 Lab Invest 8732 1 Synovial sarcoma Soft tissue t(X;18)(p11;q11) SS18/SSX4
Mann et al 2002 Br J Haematol 9799 1 Burkitt lymphoma/leukemia t(9;22)(q34;q11) BCR/ABL1
Manola et al 2008 Cancer Genet Cytogenet 12249 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(12;12)(p13;q13) ETV6+
Manor et al 2003 Cancer Genet Cytogenet 10473 1 Juvenile myelomonocytic leukemia t(4;11)(p12;q23) MLL+
Mao et al 2009 Leuk Lymphoma 12953 1 Acute promyelocytic leukemia (FAB type M3) t(9;22)(q34;q11) BCR/ABL1
Marcu et al 1983 Proc Natl Acad Sci U S A 2076 1 Burkitt lymphoma/leukemia t(8;14)(q24;q32) IGH@/MYC
Marculescu et al 2003 Nat Genet 9925 1 Nonneoplastic lymphatic disorder/lesion t(7;9)(q34;q31) TRB@/TAL2
Marino-Enriquez et al 2011 Genes Chromosomes Cancer 13425 1 Malignant epithelial tumor, special type Kidney t(2;10)(p23;q22) VCL/ALK
Mark et al 2006 Exp Mol Pathol 12371 1 Idiopathic myelofibrosis t(3;9)(q21;p24) JAK2+
Markovic et al 2000 Leukemia 8639 1 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(q12;q34;q11) BCR/ABL1
Markovic et al 2000 Leukemia 8639 2 Chronic myeloid leukemia, aberrant translocation t(2;9;22)(p13;q34;q11) BCR/ABL1
Markovic et al 2000 Leukemia 8639 3 Chronic myeloid leukemia, aberrant translocation t(4;9;22)(q12;q34;q11) BCR/ABL1
Markovic et al 2000 Leukemia 8639 4 Chronic myeloid leukemia, aberrant translocation t(3;9;22;12)(q12;q34;q11;p13) BCR/ABL1
Markovic et al 2000 Leukemia 8639 5 Chronic myeloid leukemia, aberrant translocation t(9;22;17)(q34;q11;q25) BCR/ABL1
Markovic et al 2000 Leukemia 8639 6 Chronic myeloid leukemia, aberrant translocation t(9;22;14)(q34;q11;p11) BCR/ABL1
Markovic et al 2000 Leukemia 8639 7 Chronic myeloid leukemia, aberrant translocation t(1;9;22)(p36;q34;q11) BCR/ABL1
Markovic et al 2000 Leukemia 8639 8 Chronic myeloid leukemia, aberrant translocation t(3;9;22)(p11;q34;q11) BCR/ABL1
Marlton et al 1995 Blood 5730 1 Acute myeloid leukemia, NOS inv(16)(p13q22) CBFB/MYH11
Marlton et al 1995 Blood 5730 2 Acute myeloid leukemia, NOS t(16;16)(p13;q22) CBFB/MYH11
Marques et al 2002 J Clin Endocrinol Metab 9788 1 Adenoma Thyroid t(2;3)(q13;p25) PAX8/PPARG
Marques et al 2002 J Clin Endocrinol Metab 9788 2 Adenocarcinoma Thyroid t(2;3)(q13;p25) PAX8/PPARG
Martelli et al 2009 Am J Pathol 12712 1 Adenosquamous carcinoma Lung inv(2)(p21p23) EML4/ALK
Martelli et al 2009 Am J Pathol 12712 2 Nonneoplastic epithelial disorder/lesion Lung inv(2)(p21p23) EML4/ALK
Martiat et al 1990 Leukemia 3658 1 Multiple myeloma t(9;22)(q34;q11) BCR/ABL1
Martin et al 1997 Cancer Genet Cytogenet 6870 1 Acute myeloblastic leukemia with maturation (FAB type M2) t(4;9;22)(p14;q34;q11) BCR/ABL1
Martin-Subero et al 2001 Cancer Genet Cytogenet 8931 1 Chronic myeloid leukemia, aberrant translocation ins(22;9)(q11;q34q21) BCR/ABL1
Martin-Subero et al 2002 Int J Cancer 9618 1 B-prolymphocytic leukemia t(2;8)(p11;q24) IGK@/MYC
Martin-Subero et al 2002 Int J Cancer 9618 2 Mantle cell lymphoma t(2;8)(p11;q24) IGK@/MYC
Martin-Subero et al 2002 Int J Cancer 9618 3 Follicular lymphoma t(2;8)(p11;q24) IGK@/MYC
Martin-Subero et al 2002 Int J Cancer 9618 4 Diffuse large B-cell lymphoma t(2;8)(p11;q24) IGK@/MYC
Martin-Subero et al 2002 Int J Cancer 9618 6 Extranodal marginal zone B-cell lymphoma Unknown site t(2;7)(p11;q21) IGK@+
Martin-Subero et al 2002 Int J Cancer 9618 7 Follicular lymphoma t(2;16)(p11;q24) IGK@+
Martin-Subero et al 2002 Int J Cancer 9618 8 Multiple myeloma der(22)(q11) IGL@+
Martin-Subero et al 2002 Int J Cancer 9618 9 Follicular lymphoma t(3;22)(q27;q11) IGL@/BCL6
Martin-Subero et al 2002 Int J Cancer 9618 10 Follicular lymphoma t(2;22)(p16;q11) IGL@/REL
Martin-Subero et al 2002 Int J Cancer 9618 11 Diffuse large B-cell lymphoma t(4;22)(q13;q11) IGL@+
Martin-Subero et al 2002 Int J Cancer 9618 12 Burkitt lymphoma/leukemia t(16;22)(p12;q11) IGL@+
Martin-Subero et al 2002 Blood 11081 1 Hodgkin disease, NOS der(2)(p16) REL+
Martin-Subero et al 2005 Genes Chromosomes Cancer 11012 1 Diffuse large B-cell lymphoma dmin +IGH@/MYC
Martin-Subero et al 2006 Cancer Res 12089 1 Hodgkin disease, nodular sclerosis t(3;14)(q27;q32) IGH@/BCL6
Martin-Subero et al 2006 Cancer Res 12089 2 Hodgkin disease, nodular sclerosis t(8;14)(q24;q32) IGH@/MYC
Martin-Subero et al 2006 Cancer Res 12089 3 Hodgkin disease, NOS t(2;22)(p16;q11) IGL@/REL
Martin-Subero et al 2007 Leukemia 12048 1 Splenic marginal zone B-cell lymphoma t(14;19)(q32;q13) IGH@/BCL3
Martin-Subero et al 2007 Leukemia 12048 2 Nodal marginal zone B-cell lymphoma t(14;19)(q32;q13) IGH@/BCL3
Martin-Subero et al 2007 Leukemia 12048 3 Follicular lymphoma t(14;19)(q32;q13) IGH@/BCL3
Martin-Subero et al 2007 Leukemia 12048 4 Mature B-cell neoplasm, NOS t(2;19;14)(q32;q13;q32) IGH@/BCL3
Martin-Subero et al 2007 Leukemia 12048 5 Chronic lymphocytic leukemia t(2;19;14)(p12;q13;q32) IGH@/BCL3
Martin-Subero et al 2007 Leukemia 12048 6 Mature B-cell neoplasm, NOS t(2;19)(p11;q13) IGK@/BCL3
Martin-Subero et al 2007 Leukemia 12048 7 Follicular lymphoma t(19;22)(q13;q11) IGL@/BCL3
Martin-Subero et al 2007 Leukemia 12048 8 Diffuse large B-cell lymphoma t(1;19;22)(q23;q13;q11) IGL@/BCL3
Martin-Subero et al 2007 Leukemia 12048 9 Mature B-cell neoplasm, NOS t(9;19)(p13;q13) BCL3+
Martineau et al 1998 Leukemia 7531 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(6;11)(q27;q23) MLL/MLLT4
Martineau et al 1998 Leukemia 7531 4 Acute myeloblastic leukemia without maturation (FAB type M1) t(6;11)(q27;q23) MLL/MLLT4
Martineau et al 1998 Leukemia 7531 5 Acute myeloblastic leukemia with maturation (FAB type M2) t(6;11)(q27;q23) MLL+
Martinelli et al 2003 Haematologica 10464 1 Acute myeloblastic leukemia without maturation (FAB type M1) inv(3)(q21q26) RPN1/EVI1
Martinelli et al 2003 Haematologica 10464 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(3;3)(q21;q26) RPN1/EVI1
Martinez-Climent et al 1995 Leukemia 6113 2 Acute lymphoblastic leukemia/lymphoblastic lymphoma der(11)(q23) MLL+
Martinez-Climent et al 1995 Leukemia 6113 3 Acute myeloblastic leukemia with maturation (FAB type M2) t(11;19)(q23;p13) MLL+
Martinez-Climent et al 1995 Leukemia 6113 4 Acute myelomonocytic leukemia (FAB type M4) t(10;11)(p11;q23) MLL+
Martinez-Climent et al 1995 Leukemia 6113 5 Acute monoblastic leukemia (FAB type M5) ins(10;11)(p11;q22q23) MLL+
Martinez-Climent et al 1995 J Pediatr Hematol Oncol 6276 1 Acute monoblastic leukemia without differentiation (FAB type M5a) t(11;19)(q23;p13) MLL+
Martinez-Climent et al 1995 J Pediatr Hematol Oncol 6276 2 Acute monoblastic leukemia without differentiation (FAB type M5a) t(9;11;13)(?;q23;?) MLL+
Martinez-Climent et al 1995 J Pediatr Hematol Oncol 6276 3 Acute myelomonocytic leukemia (FAB type M4) t(11;15)(q23;?) MLL+
Martini et al 2002 Cancer Res 9715 1 Acute undifferentiated leukemia t(12;22)(p13;q12) EWSR1/ZNF384
Martini et al 2002 Cancer Res 9715 2 Acute myeloblastic leukemia without maturation (FAB type M1) t(12;17)(p13;q12) TAF15/ZNF384
Martini et al 2002 Cancer Res 9715 3 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;17)(p13;q12) TAF15/ZNF384
Martini et al 2002 Cancer Res 9715 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(12;22)(p13;q12) EWSR1/ZNF384
Martins et al 2004 J Mol Diagn 10856 1 Mucoepidermoid carcinoma Salivary gland t(11;19)(q21;p13) CRTC1/MAML2
Martins et al 2005 Mod Pathol 11103 1 Adenoma Salivary gland t(8;9)(q12;p22-23) PLAG1+
Martins et al 2005 Mod Pathol 11103 2 Adenoma Salivary gland t(5;8)(p13;q12) PLAG1+
Martins et al 2005 Mod Pathol 11103 3 Adenoma Salivary gland t(8;10)(q12;q22) PLAG1+
Martins et al 2005 Mod Pathol 11103 4 Adenoma Salivary gland t(3;8)(p21;q12) PLAG1+
Martins et al 2005 Mod Pathol 11103 5 Adenoma Salivary gland t(8;15)(q12;q26) PLAG1+
Martins et al 2005 Mod Pathol 11103 6 Adenoma Salivary gland t(3;8;9)(p21;q12;p21) PLAG1+
Martins et al 2005 Mod Pathol 11103 7 Adenoma Salivary gland t(5;8)(p15;q12) PLAG1+
Martins et al 2005 Mod Pathol 11103 8 Malignant epithelial tumor, special type Salivary gland t(3;8)(p21;q12) PLAG1+
Martins et al 2005 Mod Pathol 11103 9 Malignant epithelial tumor, special type Salivary gland ins(3;8)(p21;q12q24) PLAG1+
Marukawa et al 1996 Br J Haematol 6611 1 Acute myelomonocytic leukemia (FAB type M4) t(11;22)(q23;q11) MLL+
Maseki et al 1993 Blood 4797 1 Acute myeloblastic leukemia without maturation (FAB type M1) t(8;20;21)(q22;q13;q22) RUNX1+
Maseki et al 1993 Blood 4797 2 Acute myeloblastic leukemia with maturation (FAB type M2) t(4;21;8)(q35;q22;q22) RUNX1+
Maseki et al 1993 Blood 4797 3 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;10;21)(q22;p15;q22) RUNX1+
Maseki et al 1993 Blood 4797 4 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;12;21)(q22;q13;q22) RUNX1+
Maseki et al 1993 Blood 4797 5 Acute myeloblastic leukemia with maturation (FAB type M2) t(8;17;21)(q22;q23;q22) RUNX1+
Maseki et al 1993 Blood 4797 6 Acute myeloblastic leukemia with maturation (FAB type M2) der(21)(q22) RUNX1+
Mastrangelo et al 2000 Oncogene 8769 1 Ewing tumor/peripheral primitive neuroectodermal tumor Soft tissue inv(22)(q12q12) EWSR1/PATZ1
Masuko et al 2009 Int J Hematol 13025 1 Chronic myeloid leukemia, aberrant translocation t(9;22)(q34;q11)t(9;9)(q13;q34)t(9;22) BCR/ABL1
Mathew et al 1997 Blood 6812 1 Follicular lymphoma t(2;5)(p23;q35) NPM1/ALK
Mathew et al 1997 Blood 6812 2 Peripheral T-cell lymphoma, unspecified t(2;5)(p23;q35) NPM1/ALK
Mathew et al 1999 Leukemia 8340 1 Acute myeloid leukemia, NOS t(1;11)(q21;q23) MLL+
Mathew et al 1999 Leukemia 8340 2 Acute myeloid leukemia, NOS t(7;11)(p15;q23) MLL+
Mathew et al 1999 Leukemia 8340 3 Acute myeloid leukemia, NOS ins(10;11)(p12;q22q23) MLL+
Mathew et al 1999 Leukemia 8340 4 Acute myeloid leukemia, NOS t(10;11)(p11;q23) MLL+
Mathew et al 1999 Leukemia 8340 5 Acute myeloid leukemia, NOS t(11;11)(q13;q23) MLL+
Mathew et al 1999 Leukemia 8340 6 Acute myeloid leukemia, NOS add(11)(q23) MLL+
Mathew et al 1999 Leukemia 8340 7 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;15)(q23;q15) MLL+
Mathew et al 2000 Genes Chromosomes Cancer 8525 1 Refractory anemia with excess blasts-1 t(2;11)(p23;q23) MLL+
Mathew et al 2000 Genes Chromosomes Cancer 8525 2 Refractory anemia with excess blasts-1 t(6;21)(p22;q22) RUNX1+
Mathew et al 2000 Leukemia 8634 1 Acute myeloid leukemia, NOS dmin +MYC
Mathew et al 2003 Leuk Lymphoma 10328 1 Acute myelomonocytic leukemia (FAB type M4) t(3;21;8)(q27;q22;q22) RUNX1/RUNX1T1
Mathieu-Mahul et al 1986 C R Acad Sci 1653 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(1;14)(p32;q11) TRA@+
Mathieu-Mahul et al 1986 Int J Cancer 1834 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRA@/MYC
Matsuda et al 2006 Cancer Genet Cytogenet 11666 1 Acute myeloblastic leukemia with maturation (FAB type M2) ins(10;11)(p12;q23q23) MLL/MLLT10
Matsuda et al 2009 Cancer Genet Cytogenet 12805 1 Bilineage or biphenotypic leukemia ins(11;10)(q23;p12p12) MLL/MLLT10
Matsue et al 2003 Int J Hematol 11946 1 Chronic myeloid leukemia, t(9;22) t(15;17)(q22;q21) PML/RARA
Matsuo et al 1997 Leukemia 7248 1 Acute monoblastic leukemia without differentiation (FAB type M5a) ins(11;9)(q23;p21p23) MLL/MLLT3
Matsuzaki et al 1990 Acta Haematol 3720 1 Burkitt lymphoma/leukemia t(14;18)(q32;q21) IGH@/BCL2
May et al 1993 Proc Natl Acad Sci U S A 4928 1 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22)(q24;q12) EWSR1/FLI1
May et al 1993 Mol Cell Biol 5265 1 Ewing tumor/peripheral primitive neuroectodermal tumor Unknown site t(11;22)(q24;q12) EWSR1/FLI1
Mazur et al 2005 Pediatr Blood Cancer 11250 1 Ewing tumor/peripheral primitive neuroectodermal tumor Brain t(11;22)(q24;q12) EWSR1/FLI1
McArthur et al 2005 J Clin Oncol 10860 1 Dermatofibrosarcoma protuberans/Bednar tumor/giant cell fibroblastoma Vagina t(17;22)(q21;q13) COL1A1/PDGFB
McCabe et al 1992 Proc Natl Acad Sci U S A 4708 2 Acute myeloid leukemia, NOS t(9;11)(q21;q23) MLL+
McCabe et al 1992 Proc Natl Acad Sci U S A 4708 3 Acute myeloid leukemia, NOS t(11;19)(q23;p13) MLL+
McCabe et al 1992 Proc Natl Acad Sci U S A 4708 4 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;19)(q23;p13) MLL+
McCabe et al 1994 Genes Chromosomes Cancer 5195 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(X;11)(q13;q23) MLL+
McCabe et al 2010 Cancer Genet Cytogenet 13404 1 Carcinoma, NOS Uterus, cervix del(19)(p13p13) C19ORF26/SBNO2
McCluggage et al 2007 J Clin Pathol 11998 1 Ewing tumor/peripheral primitive neuroectodermal tumor Vagina t(11;22)(q24;q12) EWSR1/FLI1
McGuire et al 1989 Mol Cell Biol 3035 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p15;q11) TRD@/LMO1
McGuire et al 1991 Blood 4500 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(11;14)(p15;q11) TRD@/LMO1
McKeithan et al 1986 Proc Natl Acad Sci U S A 1973 1 Acute lymphoblastic leukemia/lymphoblastic lymphoma t(8;14)(q24;q11) TRA@/MYC
McKeithan et al 1987 Proc Natl Acad Sci U S A 2352 1 Chronic lymphocytic leukemia t(14;19)(q32;q13) IGH@+
McKeithan et al 1990 Genes Chromosomes Cancer 3293 1 Chronic lymphocytic leukemia t(14;19)(q32;q13) IGH@/BCL3
McKinney et al 1994 Genes Chromosomes Cancer 5093 1 Acute promyelocytic leukemia (FAB type M3) t(3;17;15)(p21;q21;q22) PML/RARA
McRobert et al 1992 Cancer Genet Cytogenet 4259 1 Neuroblastoma Adrenal dmin +MYCN
Mecucci et al 2000